Cardiovascular Conditions & HBOT : simplebooklet.com

CLINICAL PROGRESS Hyperbaric Oxygen in Cardiovascular Disease Potential Usages and Hazards By HEBBERT A SALTZMAN 1 D suires are combined wvith the respiration of pure oxygen Present day medical chambers reflect this concept in their design and em Downloaded from http ahajournals org by on October 12 2022 CLINICAL interest in hyperbaric oxygenation is recent buit scientific curiosity abouit high pressuire environment dates back to ancient times Alexander the Great of Macedoinia was the earliest hyperbaric investigator of whom we have recorded evidence 2 He suirveyed the ocean depths in a glass and animal skin diving bell fig 1 Among his most remarkable observations was a fish of such extraordinary length that it required 3 days to svim by his viewing port Certainly Alexander and his biographers were not given to uinderstatement a trait they may share with subsequent workers in this field During the past two centuries scientists in many couintries have studied the biologic effects of increased environmental pressures with emphasis on the uinderwater civil and military applications of this knowledge Sporadic efforts at treatment of various illnesses with compressed air alone have proved ineffectual and been abandoned with the exception of decompression sickness 3 More recently however Boerema and associates have introduiced the hyperbaric chamber to the modern medical era by demonstrating enhanced oxygenation when increased atmospheric pres ployment In the moderni chamber alveolar oxygen te _nsions canl be increased far beyond levels achieved by any other means In practice the patient respires puire oxygen from a mask or other appropriate delivery system while the chamber is pressurized with air At several atmospherecs of environmental pressure the Froln the Departmiieint of Medicine Duke University Medical Center Durhamii North Carolina Supported in part by Grants 07896 02 01596 0851 IIE 07363 02 lIE 047 02 4 NIl 2E 2e36 IE 0756302 NIlf 8669 and 63 G 127 fromii the National Heart Institute U S Puhlic ilealtlh Service The American Heart Association and the North Carolina Heart Association The survey of the literature for the article was completed in October 1964 Figure 1 Illustration according tO a medieval F rench mlmtitiscript of Alexanrder the Great stnrveying thle oceatn fr1on a divinig bell Frontca Thirteenth Century miatnuscript courtesy of the New York Ptublic Librartar 454 Circulaion Voluinc XXXi Atarh 1965

Page 27

HYPERBARIC OXYGEN oxygen molecules breathed are crowded together and exert a proportionally greater pressure upon the alveolar air spaces and pulmonary capillaries 5 With efficient respiratory gas exchange pulmonary capillary blood will equilibrate to the same tension thereby forcing larger amounts of oxygen into free solution in blood If this increase in oxygen delivery can be translated into more effective oxygenation of tissues hyperbaric oxygenation will have dramatic therapeutic application in certain cardiovascular diseases associated with organ hypoxia Suitable examples include coronary heart disease cerebral vascular insufficiency arterial insufficiency of the extremities and surgical procedures that require temporary interruption of the circulation This review describes the known biomedical effects of hyperbaric oxygenation upon the circulation in health and in the presence of cardiovascular disease In addition the special problems associated with this modality are discussed briefly so that the limitations of present day therapy can be delineated more clearly Downloaded from http ahajournals org by on October 12 2022 Physiologic Effects Environmental air contains 20 93 per cent oxygen with a resultant inspired air tension of 149 mm Hg Dilution of this gas in the lungs lowers the effective alveolar oxygen tension to 100 110 mm Hg Other factors normally present reduce the tension to 100 mm Hg or less during the time equilibrated pulmonary capillary blood enters the systemic circulation The amount of this slightly soluble gas whieh enters free solution obeys physical laws described by Henry and is proportional to the oxygen tension Normally constituted blood will hold 0 0031 vol per cent of oxygen for each mm Hg tension exerted by that gas Therefore a 100 ml aliquot of blood would hold 0 31 ml of oxygen in free solution if the oxygen tension wvere 100 mm Hg This volume is small by comparison to the much larger 20 ml amount carried in chemical combination with oxyhemoglobin neverthe Tensions are calculated as the product of environmental dry pressure and gas concentration i e 760 water vapor pressure 47 X 0 2093 149 Circulation Volume XXXI March 1965 455 less the physiologic importance of freely dissolved oxygen is great The number of oxygen molecules forced into solution can be increased readily by a factor of 5 with respiration of pure oxygen Oxygenation can be increased still further by increasing the atmospheric pressure At 3 atmospheres of absolute pressure the alveolar oxygen tension exceeds 2 000 mm Hg and perfectly equilibrated pulmonary capillary blood would contain 6 vols per cent of oxygen in free solution an amount exceeding the over all metabolic requirements This oxygen content of blood has been experimentally determined in normal animals and man during exposure to increased atmospheric pressure 6 8 In most studies the measured values for arterial blood oxygen tension are similar to the findings in table 1 In general the anticipated linear relationship to atmospheric pressure is demonstrated readily Under the usual experimental conditions however observed values fail to equal the anticipated measurements for reasons that are not understood fully The measured arterial blood oxygen tension approaches 1 700 rather than 2 000 mm Hg at 3 atmospheres absolute with approximately 5 0 vols per cent of oxygen in free solution That physically dissolved oxygen exceeds the over all body metabolic requirements is confirmed by demonstration of 100 per cent oxygen saturation for venous blood hemoglobin Under the same experimental conditions the right atrial blood oxygen tension exceeds 400 mm Hg table 1 Certain vascular effects of hyperbaric oxygenation can be observed directly in the optic fundus in figure 1 Hyperbaric oxygenation produces two major changes in the retinal vessels when they are compared to air breathing control 9 First marked constriction occurs in both veins and arteries and smaller vessels are no longer visible The caliber of the retinal vessel decreases further as the oxygen tension rises Secondly the normal color difference between retinal venous and arterial blood is lost The general nature of the vasoconstrictive phenomenon is indicated by the calculated rise of systemic vascular resistance in normal subjects exposed to hyperbaric oxygena

Page 28

456 SALTZMAN Table 1 Mean Blood Oxygen Responses to Hyperbaric Oxygenation in Ten Normal Subjects Environmental pressure Inspired 1 1 3 04 3 04 air 100 02 air 100 02 atmosphere gas Arterial blood pO2 2 mm Hg vol 89 3 2 507 13 9 402 9 2 1721 33 5 19 1 21 2 20 8 25 2 0 32 0 51 0 51 0 51 Venous blood p02 02 content inm Hg vol 0 9 57 3 5 68 3 2 424 77 8 41 14 9 17 2 18 1 20 7 0 47 0 51 0 44 0 54 1 Standard error Table 2 HIemodynamic Effects of Hyperbaric Oxygenation in Ten Normal Subjects Environmental pressure atmospheres I 1 3 04 3 04 Inspired gas air 100 02 air 100 02 Cardiac Heart L min 6 1 0 38 beats min 75 2 5 output 5 8 0 35 5 7 0 25 5 3 0 35 rate 71 2 8 68 2 8 63 2 8 Mean blood pressure mm Hg 89 90 88 92 3 8 2 8 3 5 3 2 Peripheral resistance units 15 3 1 14 16 0 1 11 15 8 0 79 17 8 1 20 1 Standard error Downloaded from http ahajournals org by on October 12 2022 tion table 2 8 Both cardiac output and heart rate decrease moderately in this experimental setting and mean arterial blood pressure remains constant As a result measured heart work does not increase grossly The observed hyperoxygenation of venous blood suggests that tissues accumulate increased amounts of oxygen during hyperbaric exposure despite vasoconstriction and blood flow reduction This oxygen storage effect however is not easily demonstrated Miniature electrodes have been developed for insertion into tissue but seem influenced to an excessive degree by proximity to blood vessels or alterations in tissue pressure Perhaps the most valid test of tissue oxygen uptake is to determine whether normal organ function can be prolonged if perfusion is temporarily interrupted Several recent experiments of this type have demonstrated a measurable increase in tissue oxygen storage during hyperbaric oxygenation For example mean normal brain electrical activity persists for 20 seconds longer during induced circulatory arrest if the experimental animal has been hyperoxygenated at 3 04 atmospheres absolute Hyperbaric oxygenation can be demonstrated to produce similar effects in normal man as well With use of the eye as a test organ of convenience temporary retinal ischemia is produced by application of pressure over the eyeball 10 11 In the absence of perfusion vision is lost within a 10 second period during air breathing and returns promptly after release of the ischemic pressure However inhalation of 100 per cent oxygen increases the persistence of vision during ischemia to 50 seconds at 3 72 atmospheres absolute fig 2 Persistence correlates directly with the higher arterial blood oxygen tensions In addition this interval of retained vision can be extended further with the addition of carbon dioxide in small amounts to the inspired oxygen gas mixture 12 However in another series of studies Brown and associates13 have demonstrated only a modest increase in survival of a large series of dogs subjected to hyperbaric oxygenation prior to total arrest of the circulation by electronic fibrillation of the heart Only five of 14 animals survived 15 minutes of total circulatory arrest after hyperoxygenation at 4 atmospheres absolute and hypothermia Three conclusions can be drawn from these several experimental observations First hyperbaric oxygenation does increase the delivCirculation Volume XXXI March 1965

Page 29

457i I IYPIEIIBAIIIC OXYGCEN Figure 2 Photographis of optic futndis in a norm al subject left breathitig air at 1 otniosphere absoluite atid right breathinig 100 per cent oxygen at 3 04 atmospheres absolute Note the markedl decrease in size of all vessels durinig hyperbaric oxygenationl Downloaded from http ahajournals org by on October 12 2022 cry of oxygen to vulnerable tissues anid this increased oxygen supply can be utilized to prolong organ funiction in the absence of perfusion Secondly this oxygen storage effect is of itself limited and not likely to be of exceptional value to the cardiovascular anid nieuirosurgeon with present technics of application Third organ function fails promptly and inevitably in the total absence of a circulation supporting theoretical calculations and experimental observations which indicate that gas diffuses poorly through nonvascular tissue routes 4 Clinical Obserxationis of Hyperbaric Oxygenation in Cardiovascular Disease The biologic effectiveness of hyperbaric oxygenation in the treatment of medical ischemic illness is limited clearly by factors not presenit in studies of normal subjects Most important normal tissue oxygein delivery re Itilres an intact capillarx circulation and imllpaired organ perfusion is an inherent part of ischemic illness Retinal vascular occlusive disease is an easily identified clinical problem of this type In addition function of the visual organ can be measured xvith precision So far the favorable visuial fuinctional responses to hyperoxygenation have been real but small and appear limited to the initerface between perfused and nonperfuised retinal tissue 5 Circilbtiorn Volumc XXIz ilfa ch 1

Page 30

458 Downloaded from http ahajournals org by on October 12 2022 group An apparent excellent treatment response has been observed also in a youngster with purpura fulminans who developed profound peripheral ischemia pain and a blueblack discoloration of the distal extremities 7 Since the natural history of this illness is often one of gangrene amputation and loss of life the child was exposed intermittently to a total of 40 hours of hyperoxygenation at 2 atmospheres of pressure in an attempt to oxygenate the hypoxic tissues During each treatment the ischemic areas changed in color from purple to red and pain decreased noticeably This child recovered completely In another instance a 53 year old woman sustained a second myocardial infarction with cardiac arrest and resuscitation followed by sustained hypotension and a chaotic heart rhythm which could not be reversed by pharmacologic means After all therapy had failed the patient was subjected to 18 hours of hyperbaric oxygenation at 2 atmospheres of absolute pressure In the eighth hour the cardiac rhythm reverted to normal and remained stable thereafter This patient has recovered also from her illness However large case series confirming the general significance of these individually favorable responses have not been forthcoming as yet The internist has been excited most by the potential of hyperoxygenation for the treatment of severe coronary heart disease Only Cameron 8 has reported a carefully compiled and controlled series thus far He reports no difference in treatment results for 20 patients with acute myocardial infarcts who were exposed to 48 hours of hyperbaric oxygenation at 2 atmospheres absolute Furthermore the mortality of 30 per cent was identical to previous hospital experience However interpretation of this study is limited by technical problems of gas delivery and the statistical limitations of good risk case evaluation Of the six patients in the hyperoxygenated group who died five manifested cardiogenic shock prior to treatment Only one patient in the control group manifested circulatory collapse upon entering this series suggesting some difference in the clinical severity of cases in SALTZMAN the groups compared Future studies of highrisk patients should provide a more precise answer to this important question The results of treatment for peripheral ischemic illness have been inconclusive 9 Ischemic pain disappears commonly but returns after completing treatment However hyperoxygenation therapy requires further evaluation as regards extension of exercise tolerance and healing of ulcers in ischemia Hyperbaric oxygenation offers great promise to the cardiovascular surgeon particularly in the management of severe cyanotic congenital heart disease These patients often have responded unfavorably to previously available therapy An increase in oxygen tension and content during hyperbaric exposure should provide a greater tolerance to anesthesia and to circulatory arrest during surgical treatment of the cardiac abnormality Bernhard20 21 has operated on 90 children with congenital cardiac malformations with the aid of hyperbarbic oxygenation The results are impressive particularly in the cyanotic group in which 18 of 25 children have responded favorably Nevertheless7 respiratory gas exchange becomes a very inefficient means of oxygenating blood in a child with a large extrapulmonary right to left shunt Enormous tensions would be required to saturate arterial blood normally For this reason the physiologic advantages resulting from oxygen respiration alone may prove limited However the combination of hyperoxygenation efficient extracorporeal heartlung machines and hypothermia may have extraordinary value and merits very active study Special Problems Inherent in the Clinical Application of Hyperbaric Oxygenation to be Considered Carefully by Interested Groups Unfortunately the structural and hardware requirements of a hyperbaric chamber do not conform to standard architectural experience The builder and user must solve unfamiliar problems in design As a result the research hyperbaric facility becomes enormously expensive to construct and may approach a cost of 1 000 per square foot of net usable floor Circalation Volume XXXI March 1965

Page 31

HYPERBARIC OXYGEN Downloaded from http ahajournals org by on October 12 2022 space Much of this cost is inherent in the stringent safety requirements of an artificial environment and is not likely to be changed with experience Furthermore like the submarine the hyperbaric chamber requires an experienced crew familiar with the intimate details of their ship and capable of reacting instantly and correctly to changing requirements We have found that experienced Navy trained divers are particularly valuable in meeting these needs The well designed chamber provides back up systems for all essential operational components A typical example is the problem of air supply for pressurization and ventilation should the compressors fail An ideal solution is to maintain at all times an emergency 24 hour supply of air in highpressure storage flasks Fire is the most serious consequence of technical failure The problem is particularly acute here because there is no possible rapid escape from the interior of a pressurized chamber The gaseous environment instrumentation and limited volume exaggerate the hazard and fatal accidents due to fire have occurred in nonclinical facilities The advent of therapeutic chambers has made a solution to the problem more difficult since the circumstances of treatment may preclude attempts at movement of either the patient or attending personnel We have attempted to solve our problem by eliminating all possible fire hazards and by providing a specific means of control if all precautions fail The Duke Chamber contains no sparking electric motors Air powered motors drive the internal air conditioner and even turn the tonometer on the waterbath The uniforms worn by personnel and all of the surgical drapes are impregnated with a special fire retardant Although the chamber is pressurized and ventilated with air enrichment of the internal environment with oxygen or anesthetic gas would be hazardous For this reason and in order to facilitate collection for measurement expired air of oxygen breathing patients and animals is vented through a special exhaust device directly to the exterior A special partitioning valve system had to be designed in Circulation Volumine XXXI March 1965 459 order to perform this task without producing on the one hand a serious expiratory load resistance or on the other hand exposing the lungs of the patient to the large intolerable pressure gradient across the chamber wall 22 If a fire were to occur despite all precautions a fire sprinkler system has been provided which incorporates sufficient pressure produced by a booster pump to overcome the resistance of a high atmospheric pressure within the chamber The research chamber must be engineered to permit quantitative measurement if results of treatment are to be evaluated properly Every physiologic measurement made during a hyperbaric exposure requires a special engineering solution For example blood samples collected at 3 atmospheres will bubble and hemolyze if transferred outside the chamber for measurement Therefore equipment should be placed in the chamber for measurement of gas tension at the pressure of sample collection A patient subjected to a protracted hyperbaric exposure is isolated to a large extent from many of the hospital facilities that would be available ordinarily if a clinical requirement arose Therefore the operational chamber should contain essential emergency drugs and supplies including tracheotomy and cutdown trays Adequate nursing help and both integral operating and x ray facilities should be incorporated whenever possible in future clinical hyperbaric chamber construction If an acute surgical requirement were to occur during hyperoxygenation the ability to move the patient to an operating room and perform the necessary surgical therapy without decompression would offer obvious advantages Another problem peculiar to hyperbaric exposure is decompression illness or bends A bends incidence of 2 to 6 per cent is found in standard references 3 This figure is unacceptable in a medical environment Unfortunately the differing biologic characteristics of medical personnnel as compared to selected healthy young divers and the present biomedical emphasis on prolonged shallow subsurface dives increases the likelihood of in

Page 32

460 Downloaded from http ahajournals org by on October 12 2022 adequate nitrogen elimination when standard decompression tables are used Three transient visual manifestations of dysbarism occurred in our first 1 500 personnel dives 23 However the respiration of pure oxygen during the final minutes of an air decompression schedule accelerates nitrogen elimination and decreases the likelihood of nitrogen bubble formation during decompression Clinically significant symptoms have occurred only once in our personnel since oxygen breathing has been incorporated into our decompression routine Fortunately the patient has the largest margin of protection under these circumstances since he will wash out much of his tissue nitrogen while respiring pure oxygen during treatment In any case if a serious bend occurs equipment and personnel should be prepared for prompt recompression In future exposures the use of exotic gas mixtures with differing tissue solubility and clearance characteristics will require more sophisticated decompression schedules Exotic gases will be used for the patient in order to avoid prolonged exposure of pulmonary tissue to pure oxygen and for personnel so that they may function efficiently at greater environmental pressures At the present time the narcotic effects of nitrogen limit air breathing personnel to an exposure of 4 atmospheres or 45 p s i g if they hope to function at a near optimum level 24 This measureable narcotic phenomenon is particularly serious if technically difficult procedures such as cardiovascular surgery are planned Major respiratory gas delivery problems have occurred in severely ill dyspneic and only partially oriented patients Unfortunately control of the airway by intubation has served these patients poorly Pulmonary work and respiratory distress increase substantially as a result of an increased respiratory gas density during hyperbaric exposure Airway intubation aggravates respiratory distress because of the inevitable reduction in size of airway lumen This effect can be demonstrated readily in normal subjects by introducing tracheotomy fittings into a respiratory assembly and measuring pul SALTZMAN monary ventilatory and mechanical performance 25 In addition to an increase of pulmonary work airway resistance rises and flow rates decrease as would be anticipated The most serious unsolved problem for the hyperbaric therapist is oxygen toxicity Extreme hyperoxia can produce acute central nervous system symptoms and signs that terminate in convulsions and death 20 This form of oxygen toxicity is easily managed in man by discontinuing oxygen breathing promptly but limits seriously the duration of safe exposure at oxygen pressures greater than 2i2 atmospheres absolute Furthermore patients may develop oxygen convulsions more readily than normal subjects For example a patient with sickle cell disease in crisis convulsed after only 12 minutes of oxygen breathing with a measured arterial blood oxygen tension of less than 1 200 mm Hg equivalent to a 2i2 atmosphere exposure A much more serious form of oxygen toxicity occurs in the lungs with excessive exposure to hyperbaric oxygenation 27 Characteristic irreversible findings of bronchopneumonia congestion and fibrinoid hyaline membrane formation appear with subsequent failure of respiratory gas exchange This process terminates ultimately in death However an uninterrupted exposure of 3 to 5 hours does not produce symptoms of respiratory toxicity at inspired oxygen pressures of less than 3 atmospheres and forms the basis of most curremt treatment schedules A unique form of acidosis develops during hyperbaric oxygenation with displacement of acid into plasma which would otherwise be bound isohydrically to the large venous pool of reduced hemoglobin This phenomenon is caused by the less efficient buffering action of oxygenated venous hemoglobin The extent of acidosis is small and limited to the venous circulation in normal animals and man with a pCO2 rise of 5 or 6 mm Hg and pH fall of 0 01 unit 6 28 However animals subjected to hyperbaric oxygenation after surgical creation of a large venoarterial shunt demonstrated a very severe systemic acidosis despite vigorous respirator controlled ventilation In this Circulation Volume XXXI March 1965

Page 33

461 HYPERBARIC OXYGEN Downloaded from http ahajournals org by on October 12 2022 setting the loss of a large fraction of the reduced hemoglobin acid buffer the increased production of carbon dioxide and the inefficient pulmonary clearance of carbon dioxide in the presence of a venoarterial shunt bypassing the lung act synergistically and carbonic acidosis results This acidotic phenomenon becomes important clinically when children with cyanotic congenital heart disease are exposed to hyperbaric oxygenation Hyperbaric oxygenation has been shown by Mengel and associates29 to affect the red blood cell population of animals with the appearance of hemolysis 29 Hemolysis is exaggerated by dietary depletion of antioxidants such as vitamin E and appears to be largely inhibited by supplemental feeding of animals with the same antioxidant Significant hemolytic changes in patients however are rare The relation of these observations to the clinical and pathologic manifestations of oxygen toxicity noted in the central nervous system and lungs is not clear as yet If similar biochemical mechanisms are involved current studies of factors producing hemolysis may provide information leading to more effective control of oxygen toxicity hazards in many organs Summary In summary hyperbaric oxygenation produces remarkable physiologic increases in oxygen transport to body tissues However potential benefit from hyperoxygenation in the treatment of ischemic disease appears dependent upon the presence of a partially intact capillary circulation Improved means for prevention of oxygen toxicity and better technics of oxygen delivery to specific sites are required if hyperbaric oxygenation is to fulfill present hopes for therapeutic application References 1 BUDGE E A W The Alexander Book in Ethiopia London Oxford University Press 1933 p 169 2 BEEBE W Half Mile Down New York Duell Sloan and Pearce 1934 Figure 5 opposite p 32 3 BEHNKE A R SHAW L A MESSER A C THOMSON R N AND MOTLEY E P CirCirculation Volume XXXI March 1965S culatory and respiratory disturbances of acute compressed air illness and administration of oxygen as therapeutic measure Am J Physiol 114 526 1936 4 BOERMA I KROLL J A MAJNE N G LOBIN E KROOM B AND HUISKES J W High atmospheric pressure as an aid to cardiac surgery Arch chir neerl 8 193 1956 5 BROWN I W JR FuSON R L MAUNEY F M AND SMITH W W Hyperbaric oxy genation bybaroxia Current status possibilities and limitations Adv in Surg In press 6 BEHNKE A R SHAw L A SHILLING C WV THOMSON R W AND MESSER A C Studies on the effects of hyperbaric oxygen pressure Am J Physiol 107 13 1934 7 LAMBERTSON C J KOUGH R H COOPER D Y EMMEL G L LOESCHCKE H II AND SCHMnIDT C F Oxygen toxicity Effects in man of oxygen inhalation at one and 3 5 atmospheres upon blood gas transport cerebral circulation and cerebral metabolism J Appl Physiol 5 471 1953 8 WHALEN R F SALTZMAN H A HOLLOWAY D MCINTOSH H D SIEKER H O AND BROWN I WV JR Cardiovascular and blood gas responses to hyperbaric oxygenation Am J Cardiol In press 9 SALTZMAN H A HART L SIEKER H O AND DUFFY E Retinal vascular response to hyperbaric oxygenation J A M A In press 10 ANDERSON B JR AND SALTZMAN H A Retinal oxygen utilization measured by hyperbaric blackout J Arch Ophthal 72 792 1964 11 CARLISLE R LANPHIER E H AND RAHN H Hyperbaric oxygen and persistence of vision in retinal ischemia J Appl Physiol 19 914 1964 12 ANDERSON B JR SALTZMAN H A AND BARBER J In preparation 13 FUSON R L BROWN I W JR AND MAR GOLIS G Studies in circulatory arrest In preparation 14 THEWS G Die Savitsoffdiffusion in gebrin Pfluigers Arch ges Physiol 271 197 1960 15 ANDERSON B JR SALTZMAN H A AND HEYMAN A The effects of hyperbaric oxygenation on retinal arterial occlusion Arch Ophthal In press 16 HEYMAN A AND SALTZMAN H A Unpub lished observations 17 WADDELL W SALTZMAN H A FuSON R L AND HARRIS J Purpura gangrenosa treated with hyperbaric oxygenation J A M A In press 18 CAMERON A D Controlled clinical trial of oxygen at 2 atmospheres in myocardial infarction Second International Conference on Hyperbaric Oxygenation Glasgow Scotland Sep

Page 34

SALTZMAN 462 tember 1964 To be published by E and S Livingstone Ltd Edinburgh 1965 19 LEDINGHAM I McA Some clinical and experimental applications of high pressure oxygen Proc Roy Soc Med 56 999 1963 20 BERNHARD W F SOMIERS L A KRIEK H R TADAAKI A CUNANAN O 21 22 23 24 AND CARR J G Efficacy of palliative and corrective cardiovascular surgery in infants at an environmental pressure of 4 0 atmospheres absolute Abstract Circulation Suppl 3 30 47 1964 BERNHARD W F TANK E S FRITTELLI C ANqD GROSs R E Experimental and clinical cardiovascular surgery under hyperbaric conditions New England Cardiovas Soc 21 31 1963 SMITH W W AND BROWN I W JR An atmospheric pressure partitioning device for respiratory use in hyperbaric chambers In preparation ANDERSON B JR WHALEN R E AND SALTZMA H A Dysbarism in hyperbaric personnel J A M A 190 1043 1964 BEHNKE A R THOMSON R M AND MOTLEY E P Psychologic effects from breathing air 25 26 27 28 29 at 4 atmospheres pressure Am J Physiol 112 554 1935 SALTZMAN H A SIEKER H O AND DUFFY E Effects of increased atmospheric pressure upon pulmonary mechanics Clin Res 12 69 1964 BEHNKE A R JOHNSON F S POPPEN J R AND MOTLEY E P The effect of oxygen on man at pressures from 1 to 4 atmospheres Am J Physiol 110 565 1935 SMITH J L The pathologic effects due to increase of oxygen tension in the air breathed J Physiol 24 19 1899 FUsON R L SALTZMAN H A THEIRS R SMITH W W SPACH M AND BROWN I W JR Oxygen transport and acid base responses of cyanotic dogs to hyperbaric oxygenation Second International Conference on Hyperbaric Oxygenation Glasgow Scotland September 1964 to be published by E and S Livingstone Ltd Edinburgh 1965 MENGEL C E KAHN H E SMITH W W AND HORTON B D Effects of in vivo hyperoxia on erythrocytes hemolysis in mice exposed to hyperbaric oxygenation Proc Soc Exper Biol Med 116 259 1964 Downloaded from http ahajournals org by on October 12 2022 How Medicine Became a Science The latter part of the seventeenth century was dominated by the intelligence of Newton whose influence on medicine was indirect The influence of Newton was still strong at Cambridge when Stephen Hales arrived there and it is likely that the same influence may have been at work to induce Francis Hauksbee to support Cheselden s lectures on anatomy by teaching his students the mechanics of the human body The latter part of the seventeenth century saw a large field opened for observation by the development of the microscope Working with simple apparatus Hooke Malpighi and Leeuwenhoek gave accurate descriptions of many minute objects Leeuwenhoek pictured some micro organisms which have in modern times been identified as common bacteria of the mouth In the same period Robert Boyle s chemical researches showed that air was necessary for animal life and a few years later Lower and Mayow showed that it was a special part of the air which was essential for respiration unfortunately the definite discovery of oxygen was not to be made for another century ZACHARY COPE KT Some Famous General Practitioners and other Medical Historical Essays London Pitman Medical Publishing Co Ltd 1961 p 187 Circulation Volume XXXI March 1965

Page 35

ORIGINAL ARTICLE DOI http dx doi org 10 1590 S1980 220X2017051503469 Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy Altera es cardiorrespirat rias de pacientes submetidos oxigenoterapia hiperb rica Alteraciones cardiorrespiratorias de pacientes sometidos a la oxigenoterapia hiperb rica How to cite this article Martinelli B Noronha JM Sette MFM Santos IP Barrile SR Sim o JC Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy Rev Esc Enferm USP 2019 53 e03469 DOI http dx doi org 10 1590 S1980 220X2017051503469 Bruno Martinelli1 Judi Meloni Noronha 2 Maria Fernanda Misquiatti Sette2 Ieda Papille dos Santos3 Silvia Regina Barrile1 Jos Cl udio Sim o4 Universidade do Sagrado Cora o de Bauru Departamento de Gradua o e P s gradua o em Fisioterapia Bauru SP Brazil 1 Universidade do Sagrado Cora o de Bauru Departamento de Gradua o em Fisioterapia Bauru SP Brazil 2 Universidade Estadual Paulista Faculdade de Medicina de Botucatu Botucatu SP Brazil 3 Faculdade Integrada de Bauru Departamento de Gradua o em Enfermagem Bauru SP Brazil 4 Corresponding author Bruno Martinelli Universidade do Sagrado Cora o Rua Irm Arminda 10 50 Jardim Brasil CEP 17011 160 Bauru SP Brazil bnomartinelli yahoo com br www ee usp br reeusp ABSTRACT Objective To evaluate cardiorespiratory alterations due to a single session of hyperbaric oxygen therapy Method Randomized study with patients a control group and hyperbaric oxygen therapy Evaluations occurred in the beginning during and after exposure to pure oxygen above atmosphere for 2 hours Systemic blood pressure peripheral oxygen saturation pulse rate lung volume and lung capacity and maximal inspiratory and expiratory pressures were evaluated Peripheral oxygen saturation pulse rate and systemic blood pressure were evaluated during the pressurizing in the first hour Data were evaluated by means of ANOVA Mann Whitney and independent t test p

Page 36

Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy INTRODUCTION Hyperbaric oxygen therapy HBOT is a therapeutic modality that consists of an offer of pure oxygen O2 by means of a single fraction of 100 O2 in a pressurized environment a hermetically sealed chamber with hard walls hyperbaric chamber which has a pressure greater than that of the atmosphere usually between two and three atmospheres These chambers can accommodate one patient monoplace or many patients multiplace 1 The action of this therapy is complex since it is the result of a series of physiological and pharmacological mechanisms its properties contribute to the treatment of several different conditions Nowadays there are three types of oxygen therapy Normobaric oxygen surface or sea level O2 in which there is administration of O2 24 to 100 at atmospheric pressure an atmosphere absolute ATA Hyperbaric Oxygen Inhalation of 100 O2 at elevated pressures than one ATA and Hypobaric or altitude O2 at altitude due to humans physiological limitation there is a demand for a concentration of O2 higher than that inspired at sea level to avoid hypoxia 2 This therapy is indicated for decompression sickness or gas embolism traumatic air embolism gas gangrene Fournier s gangrene necrotizing soft tissue infections fasciitis myositis and cellulitis acute vasculitis triggered by allergic reaction reaction to medication or biological toxins 3 radiation injury acute anemia acute traumatic ischemia among others 1 3 Three studies have verified the hyperbaric oxygen therapy is an effective tool in the therapeutic arsenal 4 6 In addition the benefits of the use of HBOT are described in clinical and surgical diseases with promising results reducing hospitalization time and hospital costs 3 7 Absolute contraindications for HBOT use are only untreated pneumothorax and some chemotherapeutic agents especially bleomycin due to risk of pulmonary fibrosis However relative contraindications are uncontrolled epilepsy heart failure and some airway problems such as acute upper respiratory infection emphysema and previous spontaneous pneumothorax 2 Side effects that can be caused due to the application of HBOT are middle ear barotrauma and gas embolism which is the most severe complication that occurs during decompression 3 as it can lead to respiratory system toxicity dry cough retrosternal pain hemoptysis facial discomfort and pulmonary edema neurological toxicity paresthesia and seizure hearing discomforts and transient visual changes 1 2 Interestingly the biochemical and cellular effects of HBOT are not completely understood the excessive exposure of O2 in the organism was believed to cause the worsening of the lesions but the beneficial effects of this therapy were mainly observed during reperfusion 8 Such controversies are mainly due to the lack of studies that explore biochemical physiological and cellular aspects 8 9 2 Rev Esc Enferm USP 2019 53 e03469 There are studies on cardiorespiratory alterations while diving but studies on clinical disorders still need to progress and that s why this study is proposed Some studies that have evaluated cardiovascular and respiratory manifestations will be presented A study involving patients with lower limb ischemia and submitted to HBOT 2 4 ATA 100 O2 90 minutes 2 to 3 days 1 to 3 months demonstrated on one hand an increase in the airway resistance and closing volume and on the other hand a decrease in lung elastance respiratory volume respiratory rate and vital capacity heart rate slightly decreased 10 Another study that proposed a 21 session treatment 24 KPa partial pressure of oxygen 90 minutes daily caused a progressive reduction of lung flows and capacities during treatment There was partial normalization four weeks after treatment Although a decrease in conductance of small airways was observed such effect is not considered to be clinically significant for patients treated with hyperbaric oxygen in repeated treatment sessions 11 Deleterious effects of excessive oxygen exposure to the respiratory system were also evaluated in a study with 18 patients during 6 weeks of HBOT daily 90 minutes 2 4 ATA It was possible to verify that there was no alteration in lung volumes and capacities as well as in the capacity of diffusion of carbon monoxide 12 The HBOT 2 5 ATA 90 minutes in 10 moderately active men did not increase the partial venous oxygen pressure transcutaneous oxygen tension and maximal oxygen consumption The measurements of transcutaneous and blood oxygen after the hyperbaric did not have ergogenic benefits 13 In the experimental model hyperbaric hyperoxemia has been shown to acutely induce deleterious effects on respiratory mechanics such as the elastance and the viscoelastic components of inspiratory resistance 14 As shown it is possible to conjecture that a single session of HBOT causes an increase in peripheral oxygen saturation and a reduction of cardiovascular and respiratory variables Thus to study the complexity and repercussions of HBOT is relevant to science not only for its properties and for benefits but for its indication which becomes more frequent Therefore the objective of this study was to evaluate the cardiorespiratory modifications of patients submitted to a single session of HBOT METHOD Type of sTudy Randomized clinical trial populaTion Patients with an indication for the use of the hyperbaric chamber Oxibarimed Hyperbaric Medicine Inclusion criteria adults female and male with respiratory and cardiac stability medical indication for the application of hyperbaric oxygen therapy Exclusion www ee usp br reeusp

Page 37

Martinelli B Noronha JM Sette MFM Santos IP Barrile SR Sim o JC criteria individuals who presented difficulties in the understanding and execution of the evaluative maneuvers physical and emotional malaise during pressurizing thoracic drainage hyperthermia a history of untreated seizures which were in the postoperative of otorhinolaryngeal and thoracic surgery patients with spherocytosis claustrophobia and the pregnant women definiTion of The sample The probabilistic sampling was composed of 16 patients with an indication for HBOT The sample calculation was determined by a pilot study Enrollment Patients were divided in two groups control without pressurization i e without HBOT staying in a specific room with ambient air and group under pressurization HBOT daTa collecTion Both groups were evaluated at three moments without pressurization basal after 35 minutes and after 120 minutes final The evaluation after 35 minutes of therapy was defined because of the moment corresponding to the interval stipulated by the monitoring team At that moment it was possible to observe systemic blood pressure peripheral oxygen saturation and pulse rate After a five minute interval there was continuous use of O2 again Figure 1 Assessed for eligibility n 16 Excluded n 2 Declined to participate n 2 Randomized n 14 Allocation Allocated to intervention n 7 Allocated to control group n 7 Analysis Analysed n 7 Initial BP HR SpO2 LVC MV MIP MEP Hiperbaric after 65 min BP HR SpO2 End BP HR SpO2 LVC MV MIP MEP Analysed n 7 Initial BP HR SpO2 LVC MV MIP MEP Ambient air after 65 min BP HR SpO2 End BP HR SpO2 LVC MV MIP MEP Caption BP blood pressure mmHg HR heart rate bpm SpO2 peripheral oxygen saturation LVC Low vital capacity l MV minute volume l min MIP maximum inspiratory pressure cmH2O MEP maximum expiratory pressure cmH2O Figure 1 Flow chart with the stages of the study and the analysis of patients with an indication of HBOT Body mass index BMI was calculated based on the formula weight height Kg m2 to obtain the body size of volunteers according to the World Health Organization 15 Physical activity was classified as regular irregular and sedentary according to the definitions regular physical exercises in the free time three or more times per week irregular physical exercises up to two times per week sedentary no physical exercise In addition cardiorespiratory parameters were measured Patients were positioned seated in a comfortable position resting for 5 minutes To check systemic blood pressure BP systolic SBP and diastolic DBP mmHg we used an automatic digital arm blood pressure monitor model 2005 Bioland Technology China INMETRO ML 01602010 and followed the guidelines of the Brazilian Society of Cardiology Sociedade Brasileira de Cardiologia www ee usp br reeusp Brazilian Society of Hypertension Sociedade Brasileira de Hipertens o and Brazilian Society of Nephrology Sociedade Brasileira de Nefrologia 16 Pulse rate PR bpm and peripheral oxygen saturation SpO2 were checked by the adult finger pulse oximeter PM100C New Tech EUA positioned on the fifth finger of the hand Slow Vital Capacity SVC and volume per minute VM L min were measured by the Mark 8 Wright analog respirometer Ferraris United Kingdom with a one minute interval between trials CV maneuver was performed by deep inspiration to total lung capacity and right in the sequence by a slow and maximum expiration until the residual volume 17 18 We used an analog pressure gauge Comercial M dica Brazil with a scale between 0 and 120 cmH2O to measure Rev Esc Enferm USP 2019 53 e03469 3

Page 38

Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy 50 min O2 chamber pressurization took about 15 minutes six meters They should put on the oxygen masks and stay with it for 50 minutes 15 meters 2 5 ATA In the sequence there was a scheduled 5 minute interval in which the mask was taken so the patients could drink water if necessary or desired After this interval the mask was placed again and patients were given 100 oxygen for an additional 45 minutes until the moment of the depressurizing Patients used the mask for other 5 minutes until depressurizing by three meters and then removed the mask The chamber was fully depressurized for a period of approximately 10 minutes patients were then released This process is illustrated in Figure 2 OXYGEN MASK USE OXYGEN MASK USE 0m 1m 2m 15 min 3m 4m 5m 6m 7m 8m 9m 10 m 11 m 12 m 13 m 14 m 15 m OXYGEN MASK NO USE the maximum respiratory pressures and a nose clip to avoid air leakage Maximum inspiratory MIP and expiratory MEP pressures were measured with maneuvers performed between the Residual Volume RV and the Total Vital Capacity TVC 19 20 Patients who underwent hyperbaric oxygen therapy were positioned in a multiplace hyperbaric chamber A240 SeawayDiver Brazil which is a pressurized ambient under pressure greater than an absolute atmosphere approximately 2 5 ATA with intermittent ventilation of pure oxygen 100 This session occurred in the morning and lasted 2 hours After the patients had been positioned in the 45 min O2 INTERVAL 5 min 0m 1m 5 min 2m OXYGEN 3m MASK 4m NO USE 5m 6m 7m 8m 9m 10 min 10 m 11 m 12 m 13 m 14 m 15 m DECOMPRESSION 35 min Figure 2 Diagram illustrating the pressure atmospheres absolute and time of the hyperbaric chamber daTa analysis and TreaTmenT Descriptive data were presented with the absolute and relative distribution The Shapiro Wilk test was used to perform the analysis of data distribution Regarding the comparative analysis intragroup baseline after 35 minutes and final the ANOVA with repeated measures was used consequently for the comparative analysis intergroup independent t test normal distribution and Mann Whitney test non normal distribution were used The central tendency measures are average standard deviation and median interquartile range respectively p 0 05 The software used was the Sigma Test 12 0 eThical aspecTs This study was approved by the Research Ethics Committee of the Universidade do Sagrado Cora o on the 22nd of April 2015 under n 1 031 237 It complied with the precepts of the Resolution n 466 12 of the National Health Council RESULTS A total of 14 patients were evaluated six 42 85 women and eight 57 15 men aged 55 2 14 29 years 4 Rev Esc Enferm USP 2019 53 e03469 with a weight of 80 5 21 6 kg and a height of 1 71 0 12 m Regarding ethnicity seven 50 were white and seven 50 were brown The main diagnostic hypotheses were a venous ulcer osteomyelitis postoperative of general surgery and Fournier s syndrome Regarding social habits three 21 42 were smokers one 7 14 former smoker two 14 28 regularly practiced physical activities two 14 28 irregularly practiced physical activities and the others were sedentary Specifically the control group n 7 had four 57 15 men with a weight of 82 14 20 kg and a height of 1 66 0 11 m Most individuals in this group were white only one 14 28 was brown one 14 28 was a smoker and one 14 28 was a former smoker only two 28 57 regularly practiced physical activities and one 14 28 irregularly In the group under therapy n 7 there were four men 57 15 with a weight of 78 8 24 54 kg and a height of 1 76 0 11 m Most individuals in this group were brown only one 14 28 was white In this group two 28 57 were smokers and the others weren t only one 14 28 regularly practiced physical activities Table 1 shows the basal data collected from both groups www ee usp br reeusp

Page 39

Martinelli B Noronha JM Sette MFM Santos IP Barrile SR Sim o JC Table 1 Description of the baseline anthropometric and cardiorespiratory characteristics from both groups Bauru SP Brazil 2016 Variable Group Variable Age years Control n 7 HBOT n 7 60 85 12 48 49 57 14 59 BMI Kg m 29 55 6 45 24 80 4 39 SBP mmHg 138 71 40 96 139 14 25 90 DBP mmHg 76 85 24 39 85 42 18 40 SpO2 94 14 4 59 94 71 2 36 HR bpm 78 28 16 54 83 42 8 20 RR bpm 21 14 4 59 16 00 5 56 MV l min 16 81 8 81 20 81 7 06 LVC l 4 34 0 88 5 20 1 13 MIP cmH2O 61 71 31 14 81 71 41 23 MEP cmH2O 53 71 31 98 82 28 34 93 Caption HBOT hyperbaric oxygen therapy BMI body mass index SBP systolic blood pressure DBP diastolic blood pressure SpO2 peripheral oxygen saturation HR heart rate RR respiratory rate MV minute volume LVC low vital capacity MIP maximum inspiratory pressure MEP maximum expiratory pressure Statistical analyses showed there was no significant difference between the analyzed groups Regarding the intragroup analysis there was no statistically significant difference in the control group for any of the variables studied however in the group under therapy there was a difference in the pulse rate in the comparison between baseline and 35 minutes of therapy Table 2 shows the variables in the three moments of the group under therapy hyperbaric Table 2 Results of the peripheral oxygen saturation and cardiac variables in the initial moment after 35 minutes and in the final moment of the group under therapy Bauru SP Brazil 2016 Time Variables Initial 35 min Final SBP mmHg 139 14 25 9 122 85 29 27 135 714 29 33 DBP mmHg 85 42 18 40 88 57 26 09 77 429 18 34 HR bpm 83 42 8 20 66 57 14 92 72 143 9 08 SpO2 94 71 2 36 98 57 0 53 95 571 5 09 Caption comparation between initial and 35 min time p

Page 40

Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy gases in the pulmonary alveoli increases proportionally from the partial pressures of O2 until reaching hyperbaric hyperoxia This increase in the content of the arterial O2 in percentage increases for various concentrations of hemoglobin compared to conditions of normoxia and hyperbaric hyperoxia three ATA hemoglobin in the venous blood still remains practically saturated for some time after which explains the increase in peripheral saturation observed in this study 13 21 Within this context it is possible to present the benefits and harms of O2 The oxygen is considered a drug that can be easily administered under normobaric conditions In addition the medical O2 is the most widely used gas in the medical and emergency areas this medical gas is considered a pharmaceutical product and if there is a failure in this supply of O2 it is necessary to resort to its therapeutic application Damagingly the inhalation of high doses of O2 can increase the formation of free radicals that can lead to oxidation of tissue chemical components 2 22 oxidative damage of deoxyribonucleic acid DNA and a worsening in the rate of cell death 5 The benefits of hyperbaric oxygen therapy are derived from the physiological and pharmacological effects of O2 in high doses These were classified as systemic effects of the HBOT a depression of the activities of the carotid and aortic receptors an increase in arterial content of O2 bradycardia a decrease of cardiac output and peripheral vasoconstriction and an increase of the systemic vascular resistance 23 Physiologists have identified bradycardia when the human body undergoes pressure changes 24 In the current study bradycardia was verified after 65 minutes of therapy in 15 meters 2 5 ATA and after 50 minutes of exposition to 100 O2 This finding corroborates with other pieces of evidence Responses of the cardiovascular system to hyperbaric hyperoxia were verified vasoconstriction hypertension and a decrease in the heart rate and consequently in the cardiac output Initially these responses at moderate levels of hyperbaric hyperoxia are coordinated by baroreflex mechanism mediated by vasoconstriction Furthermore baroreceptor activation inhibits sympathetic outflow and may partially reverse an O2 dependent increase in blood pressure 25 The explanations for these phenomena have been detailed The heart rate modulation was analyzed during hyperbaric pressure in 10 divers exposed to one two three and four ATA Bradycardia was confirmed with the increase in pressure it is interesting to mention that the fall in HR reached statistical significance after two ATA i e That is increased pressure caused an increase in bradycardia and cardiac modulation predominated in the high frequency parasympathetic 26 In another study motivated by the information that exposure to supranormal O2 pressures induces bradycardia and peripheral vasoconstriction four situations were created with and without a hyperbaric treatment at different pressures one and 2 5 ATA and inspired fractions of O2 21 and 100 to be tested on healthy volunteers Again HR decreased during all interventions but with no 6 Rev Esc Enferm USP 2019 53 e03469 difference between sessions The data suggest that hyper and normobaric hyperoxia increases the parasympathetic influx in cardiac regulation 27 In the following year the same authors conducted research again but this time with professional divers maintaining both situations 100 hyperbaric oxygen in 2 5 ATA and 21 hyperbaric air in 2 5 ATA HR decreased but the response was similar in both treatments There were no alterations in cardiac conduction or incidence of arrhythmias however 100 O 2 at 2 5 ATA caused a marked increase in the parasympathetic tone 28 Within an animal model the effect from one to five bar of O2 in conscious and anesthetized rats was studied Exposure to O2 stimulates the myocardium by elevating left ventricular pressure and pulse pressure The arrhythmia condition was observed in both groups however bradycardia occurred only in the state of consciousness 29 In contrast a literature review that compared normal and hyperbaric ambient verified the heart rate p 0 1468 0 05 showed a significant difference between the verified types of ambient The maximum O2 consumption p 0 00013

Page 41

Page 42

Cardiorespiratory alterations in patients undergoing hyperbaric oxygen therapy 13 Hodges ANH Delaney S Lecomte JM Lacroix VJ Montgomery DL Effect of hyperbaric oxygen on oxygen uptake and measurements in the blood an tissues in a normobaric environment Br J Sports Med 2003 37 516 20 DOI http dx doi org 10 1136 bjsm 37 6 516 14 Rubini A Porzionato A Zara S Cataldi A Garetto G Bosco G The effects of acute exposure to hyperbaric oxygen on respiratory system mechanics in the rat Lung 2013 191 5 459 66 DOI http dx doi org 10 1007 s00408 013 9488 y 15 World Health Organization WHO Expert Consultation Appropriate body mass index for Asian populations and its implications for policy and intervention strategies Lancet 2004 363 9403 157 63 DOI http dx doi org 10 1016 S0140 6736 03 15268 3 16 Malachias MVB Souza WKSB Plavnik FL Rodrigues CIS Brand o AA Neves MFT et al 7 Diretriz Brasileira de Hipertens o Arterial Arq Bras Cardiol Internet 2016 citado 2016 out 10 107 Supl 3 1 83 Dispon vel em http publicacoes cardiol br 2014 diretrizes 2016 05_ HIPERTENSAO_ARTERIAL pdf 17 Azeredo CAC Fisioterapia respirat ria moderna 4 ed Barueri Manole 1999 18 Costa D Fisioterapia respirat ria b sica S o Paulo Atheneu 2000 19 Black LF Hyatt RE Maximal respiratory pressures normal values and relationship to age and sex Am Rev Respir Dis 1969 99 5 696 702 DOI 10 1164 arrd 1969 99 5 696 20 Souza RB Press es respirat rias est ticas m ximas J Pneumol 2002 28 Supl 3 155 65 21 Iazzetti PE Mantovani M Hiperoxia Hiperb rica em infec es graves e sepse conceito e perspectivas Medicina Ribeir o Preto Internet 1998 citado 2016 ago 16 31 3 412 23 Dispon vel em http www revistas usp br rmrp article view 7695 9233 22 Lima DR Luna RL Andrade GN Cardiologia Rio de Janeiro Medsi 1989 23 Tolentino EC Ferez O Oliveira GR Ramalho FS Ramalho LNZ Zucoloto S et al Oxigenoterapia hiperb rica e regenera o hep tica Acta Cir Bras Internet 2003 citado 2016 ago 17 18 Supl 5 4 5 Dispon vel em http www scielo br pdf acb v18s5 a02v18s5 pdf 24 Butler PJ Woakes AJ Heart rate in humans during underwater swimming with and without breath hold Respir Phisiol 1987 69 3 387 99 25 hyperbaric oxygen J Appl Physiol 2013 115 6 819 28 DOI 10 1152 japplphysiol 00625 2013 26 Barbosa E Garc a Manso JM Mart n Gonz lez JM Sarmiento S Calder n FJ Silva Grigotetto ME Effect of hyperbaric pressure during scuba diving on autonomic modulation of the cardiac response application of the continuous wavelet transform to the analysis of heart rate variability Mil Med 2010 175 1 61 4 27 Lund VE Kentala E Scheinin H Klossner J Helenius H Sariola Heinonen K et al Heart rate variability in healthy volunteers during normobaric and hyperbaric hyperoxia Acta Physiol Scand 1999 167 1 29 35 DOI 10 1046 j 1365 201x 1999 00581 x 28 Lund Y Kentala E Scheinin H Klossner J Sariola Heinonen K Jalonen J Hyperbaric oxygen increases parasympathetic activity in professional divers Acta Physiol Scand 2000 170 1 39 44 DOI 10 1046 j 1365 201x 2000 00761 x 29 Stuhr LE Bergo GW Tyssebotn I Systemic hemodynamics during hyperbaric oxygen exposure in rats Aviat Space Environ Med 1994 65 6 531 8 30 Moreira CA Dantas EHM Pot ncia aer bica m xima frequ ncia card aca e capacidade vital em ambientes normo e hiperb rico Rev Bras Med Esporte Internet 1999 citado 2016 out 21 5 5 183 6 Dispon vel em http www scielo br pdf rbme v5n5 a05v5n5 pdf This is an open access article distributed under the terms of the Creative Commons Attribution License 8 Rev Esc Enferm USP 2019 53 e03469 www ee usp br reeusp

Page 43

Pretreatment with Hyperbaric Oxygen and its effect on neuropsychometric dysfunction and systemic inflammatory response after cardiopulmonary bypass 1 J Thorac Cardiovasc Surg 2005 Dec 130 6 1623 30 Epub 2005 Oct 26 Alex J Laden G Cale AR Bennett S Flowers K Madden L Gardiner E McCollum PT Griffin SC Department of Cardiothoracic Surgery Castle Hill Hospital United Kingdom OBJECTIVE Animal studies have shown that pretreatment with Hyperbaric Oxygen can induce central nervous system ischemic tolerance and also modulate the inflammatory response We evaluated this therapy in patients undergoing cardiopulmonary bypass METHODS Sixty four patients were prospectively randomized to group A n 31 atmospheric air 1 5 atmospheres absolute or group B n 33 hyperbaric oxygen 2 4 atmospheres absolute before on pump coronary artery bypass grafting Age sex body mass index diabetes hypertension smoking coronary disease severity left ventricular function Parsonnet score Euroscore bypass time myocardial ischemia time and number of grafts were comparable in both groups Canadian Cardiovascular Society angina New York Heart Association dyspnea and previous myocardial infarction were significantly higher in group B Inflammatory markers were analyzed before surgery and 2 and 24 hours after bypass Neuropsychometric testing was performed 48 hours before surgery and 4 months after surgery and included trail making A and B the Rey auditory verbal learning test grooved peg board information processing table A and digit span forward and backward Neuropsychometric dysfunction was defined as more than 1 SD deterioration in more than 2 neuropsychometric tests Chi square tests Fisher tests t tests and analysis of variance were used as appropriate for statistical analysis RESULTS Group A had a significant postoperative increase in the inflammatory markers soluble E selectin CD18 and heat shock protein 70 This was not observed in group B Neuropsychometric dysfunction was also significantly higher in group A compared with group B There was no difference in any other early postoperative clinical outcome CONCLUSIONS Our results seem to indicate that pretreatment with Hyperbaric Oxygen can reduce neuropsychometric dysfunction and also modulate the inflammatory response after cardiopulmonary bypass HYPERBARIC OXYGEN IN THE TREATMENT OF THE POSTOPERATIVE LOW CARDIAC OUTPUT SYNDROME M H YACOUB M B Cairo F R C S F R C S E F R C S G SENIOR SURGICAL REGISTRAR G L ZEITLIN M B Cantab F F A R C S SENIOR ANAESTHETIC REGISTRAR LONDON CHEST HOSPITAL LONDON E 2 It has been our experience that patients who develop the low cardiac output syndrome in association with pulmonary hypertension after cardiac surgery seldom recover despite vigorous treatment We report here the case of a patient who was successfully treated by means of hyperbaric oxygen therapy Case report a 50 yr old man was admitted to the London Chest Hospital on Oct 23 1964 He had a history of productive cough recurrent haemoptysis and dyspnoea on exertion for 21 years He had been discharged from the Army 20 years before with mitral valve disease Mr J R Belcher performed the operation on Nov 3 1964 after the operation the patient displayed all the signs of a low cardiac output failure to recover consciousness with no localizing cerebral signs severe peripheral cyanosis and a very slow capillary refill in the limbs Since the patient s condition was now desperate it was decided to use hyperbaric oxygen therapy He was placed in the Vickers mobile chamber at a pressure of 2 atmospheres absolute Since there were no facilities in the chamber for artificial respiration transfusion or drainage these had to be discontinued

Page 44

The patient s condition began to improve after an hour inside the chamber he was taken out of it every 2 hours to aspirate from his bronchial tree the considerable amount of heavily bloodstained sputum After 12 hours treatment he began to move and gradually recovered consciousness for the first time since the operation Summary and Conclusions In the immediate postoperative period after mitral valvotomy a patient who had shown signs of pulmonary hypertension preoperatively and a raised pulmonary artery pressure at thoracotomy displayed all the signs of low cardiac output In an attempt to lower the pulmonary vascular resistance and raise the cardiac output he was artificially ventilated with 100 oxygen This was ineffective and the patient s death seemed certain Hyperbaric oxygen treatment was then instituted Within an hour his condition began to improve and though artificial ventilation pleural drainage endotracheal suction and intravenous therapy were not feasible he continued to improve while in the chamber This case suggests that hyperbaric oxygen therapy helps to support life during the critical period of post operative low cardiac output in patients with pulmonary hypertension and justifies further trial of the technique in similar cases Abstracted from the Lancet March 13th 1965 pages 581 583 Yacoub is now Prof Sir MH Yacoub N B The patient was treated in an ambulance in the car park of the hospital Philip James M D Wolfson Hyperbaric Medicine Unit The University of Dundee 1999 Cardiac arrest of 30 minutes with defibrillation Male aged 46 had a cardiac arrest in the community Defibrillated by paramedics after about 30 minutes Admitted to CCU and opened his eyes after three days He began to say single words on day 5 Transferred to general ward on day 6 Gradually declined over 5 weeks with the development of spastic paraplegia despite daily physiotherapy Prescribed His leg spasticity became so severe that it was very difficult to bend his legs to allow him to use a wheelchair His arms were also developing mild stiffness He had periods in which he spoke20 words clearly but they made little sense He recognized his family Hyperbaric oxygen therapy was started after 5 weeks 54 daily one hour hyperbaric oxygen sessions were undertaken at 1 75 atm abs His cognition and speech improved and there was dramatic improvement in his spasticity He left hospital walking without assistance Comment This illustrates Ischemia with mid brain edema Giving high dosage oxygen post arrest would on present evidence have prevented the associated the reperfusion injury and spared some of the cortical damage Philip James M D Wolfson Hyperbaric Medicine Unit University of Dundee Hyperbaric Oxygen and Your Heart by Medical Journalist Morton Walker D P M USA

Page 45

What s the first treatment an emergency room doctor would administer to you if you were wheeled into the E R with angina pain or a heart attack After evaluating my question if your answer is An oxygen mask you are correct In angina pectoris you have a literal suffocation of the heart It simply isn t getting the oxygen it needs because of an insufficient blood supply that ordinarily carries cellular oxygen molecules This deficiency can be from blocked arteries heading toward the heart or from a temporary vasoconstriction of those same arteries as occurs in stress In a heart attack there is an occlusion also due to blockage or constriction but such clogging involves the coronary arteries which actually feed the heart muscle This lake of nourishing blood to the pumping muscle most commonly leads to myocardial infarction development of a dead part within the heart and could very well result in the victim s death Recognition of oxygen s physiological importance is age old knowledge but only recently has medical science provided us with guidelines as to how much and when Simple cause and effect has been the basis of most of our past wisdom For example we feel better when we exercise increasing our oxygen intake Today many doctors are utilizing hyperoxia forcefully increasing oxygen intake by use of an oxygen O2 mask or chamber as a part of their overall therapy in reversing or treating heart disease There are perhaps only two main reasons why all doctors aren t routinely using pressurized oxygen hyperbaric oxygen therapy HBOT First is ignorance as to its efficacy for a wide variety of ailments and second is the unavailability of hyperbaric medicine chambers for the delivery of oxygen under pressure Cardiac Therapy After being exposed to the pioneering work of hyperbaricist George Hart MD at the American Heart Association s AHA 65th Scientific Session held in New Orleans on November 16 1992 the AHA issued a press release praising the use of hyperbaric oxygen to boost emergency treatment for heart attack It advised medical journalists that hyperbaric oxygen HBO as treatment enhances clot dissolving drugs ability to minimize heart damage and save the lives of heart attack patients The addition of HBOT resulted in earlier relief of chest pain and electrocardiogram ECG changes toward normal in patients treated with the clot dissolver tissue plasminogen activator TPA HBOT also tended to preserve more of the heart s blood pumping capacity compared to treatment with TPA alone said Myrvin H Ellestad MD director of research at the Memorial Heart Institute at Long Beach Memorial Medical Center in Long Beach California Laboratory studies have shown that hyperbaric oxygen minimizes cell damage and death by reducing fluid accumulation in the injured cells We believe the same thing happens in patients said Dr Ellestad In heart attacks sort of the last straw that kills cells is increasing cell water which finally breaks the cell membrane We believe hyperbaric oxygen s primary effect in heart attack may be to reduce edema fluid accumulation in heart cells The Long Beach group studied forty six heart attack patients twenty two of whom received only TPA The remaining twenty four patients got TPA followed by two hours of treatment in a hyperbaric chamber It provided a pure oxygen environment with twice the normal atmospheric pressure two atmospheres absolute Patients treated with HBOT felt chest pain relief an average of 271 minutes after the onset of heart attack symptoms a statistically significant difference compared to the 671 minutes for patients who received only TPA Dr Ellestad said patients generally reported an easing of chest pain within ten minutes of entering the hyperbaric chamber

Page 46

HBO therapy reduced by 50 percent the time required for the heart to resume normal electrical activity as determined by an electrocardiogram ECG finding called ST normalization S and T waves are two points on an ECG tracing The time was 188 minutes for patients who went into the chamber vs 374 for those who did not We ve clearly shown that pain goes away very quickly and ST elevation which we think is a sign of the heart muscle dying returns to normal more rapidly said Dr Ellestad To me the most dramatic aspect of the study was watching as ST elevation returned to normal after a patient went into the chamber That tells me we re salvaging heart muscle cells There s some evidence that HBOT decreases activity by oxygen free radicals These are unstable molecules known to damage or destroy cells Two other findings provided additional evidence of benefits from HBO therapy Patients sent to the chamber had significantly lower blood levels of the enzyme creatine phosphokinase which is released during a heart attack and indicates the extent of heart muscle damage Patients treated in the hyperbaric chamber also had a higher ejection fraction a measurement that reflects how well the heart can pump blood Dr Ellestad sees potential for even better results with HBOT if patients can begin oxygen therapy sooner Transporting patients to the chamber and preparing them for treatment require about thirty minutes He and his colleagues hope to reduce that time at Long Beach Memorial by relocating the hyperbaric chamber to the hospital s emergency room Physician interest in HBO treatment for heart attack patients goes back a number of years however the interest had dwindled after the emergence of TPA and other clot dissolving agents Then an unusual event prompted Dr Ellestad and his colleagues to take another look at HBOT George Hart MD director of the hyperbaric unit at the hospital and an investigator in the study reported at the AHA 1992 New Orleans meeting began having chest pains and decided to treat himself in the oxygen chamber The HBOT relieved his heart pain in minutes Being friends Dr Ellestad checked out what Dr Hart explained about his HBOT experience Hyperbaric chambers are not standard equipment at hospitals and medical centers If HBOT proved beneficial for a hospital most likely it could afford the 80 000 to 90 000 cost for a single patient chamber This is the type used in the test at Long Beach Memorial Hospital HBOT adds about 200 to the daily cost of treating a heart attack patient Dr Ellestad said Besides Drs Ellestad and Hart investigators in the study included Adrian H Shandling MD John C Messenger MD Bruce VanNatta MD Daniel D Whitcraft MD Roger H Rizi MD Ronald H Selvester MD Michael Hayes MD and Clyde W Smith MD More Studies Show the Efficacy of HBO for Heart Disease The Long Beach Memorial Hospital s investigation is just one among thousands proving the efficacy of HBO for heart disease Medical professionals and hyperbaric scientists around the world have proven the benefits of applying HBO for the reduction of actual reversal of most heart disease signs and symptoms Their presentations are highly significant for furthering heart health The renowned Russian hyperbaricist Serge I Rodionov MD who practices HBOT in Moscow told how pharmaceutical agents prescribed for the treatment of cerebrovascular disease cardiomyopathy and heart failure are potentiated by hyperbarics Drug effects increased when the heart patient was placed in a pressure chamber for just one hour per week

Page 47

By the date of his 1989 lecture Dr Rodionov affirmed there were over 3 000 HBO chambers strategically located around the country which was then the original Union of Soviet Socialist Republics And he said acceptance of the modality was gaining in the medical community for the treatment of heart disease Today just in the newly formed smaller nation of Russia itself 3 000 chambers have been installed and are functioning Thirteen Benefits the Heart Receives from Oxygen Under Pressure The nature of heart disease is such that insufficient oxygen is getting to the heart This results in the various discomforts which affect a patient difficulty breathing inability to exert oneself pressure in the chest and other problems Breathing normal air results in a mere 0 3 ml of oxygen dissolving into each 100 ml of blood Any other oxygen is bound by the hemoglobin attached to red blood cells and it essentially becomes unavailable The need in heart disease is to get more oxygen molecules into the body and brain From the published scientific papers on HBO Dr Steenblock offers thirteen true benefits that the heart receives from exposure to oxygen under pressure Clinical investigations by prime users of HBO from around the world especially from Russian exponents have shown the following heart advantages 1 Hyperbaric oxygen therapy applied to the heart during critical loss of oxygen exerts a remarkable defibrillating effect so that tremulous rapid ineffectual contractions are prevented total death of the heart muscle cells is avoided and abnormal dilation of the blood vessels with subsequent complications is controlled 2 Using HBOT in conjunction with various drugs enhances the effectiveness of both the oxygen and the drugs 3 Combining HBOT with drugs completely arrests or considerably reduces angina attacks in patients otherwise resistant to prolonged drug treatment 4 Patients with cardiac pain from ischemic heart disease experience total relief along with disappearance of dyspnea difficulty breathing when they receive HBOT 5 Administering HBOT lowered elevated blood cholesterol in all 220 patients cited in a study conducted by the Russian internist Dr S A Borukhov and her colleagues 6 HBOT normalized electrocardiograms in all patients in that same Soviet study 7 For diminished muscular power of the heart HBO exerts long term normalizing effects for circulating blood through the body 8 HBOT exerts antiarrhythmic action on the heart 9 HBOT increases heart patients tolerance to hard work and taking on physical loads 10 HBO taken at three atmospheres of pressure a pressure rarely used in the United States protects any individual s heart from damages due to lack of oxygen 11 One s entire heart conduction system functions better from receiving HBO treatment even when prophylactically administered 12 Without taking drugs of any kind breathing oxygen under pressure stabilizes impaired fat metabolism and improves liver function for someone with ischemic heart disease 13 Due to its characteristic of mollifying stress and distress HBO has long term and short term protective effects for a person with a heart problem How HBOT Further Enhances the Ailing Heart As a result of elevating the atmospheric pressure inside the hyperbaric chamber by 1 1 2 to 2 atmospheres absolute ATA plus administering 100 percent oxygen to the cardiac patient by means of a face mask this ill person receives a sharply increased amount of oxygen dissolved in the plasma Such improved blood oxygen content tends to give the damaged heart an assist in oxygenating body tissues which provides time for the myocardium to recover and develop

Page 48

extra circulation around the area of the infarct a localized area of decay in the heart muscle resulting from the interruption in blood supply As shown in the studies cited above hyperbaric oxygen therapy for the relief of myocardial infarction has tremendous value for recovery of the patient It increases oxygen intake for building collateral circulation in cases of angina pectoris as well HBO should not be reserved only for patients in cardiac intensive care units Family practice physicians sometimes stop themselves from requesting HBO therapy for their cardiac patients because they suspect there s a vasoconstrictive effect of HBO Erroneously the doctors may conclude that such treatment is dangerous and shouldn t be utilized on already constricted blood vessels That s not true Medical studies well performed according to the scientific method show that hyperoxic vasoconstriction occurs in healthy tissue only On the damaged ischemic tissue vasodilation that occurs naturally counteracts any vasoconstriction produced by HBO Higher amounts of blood flowing to areas of hypoxia create the opening of collateral blood vessels Hyperbaric oxygen therapy is an assist to the body s own healing mechanism By itself HBO would probably not offer the desired results Numerous studies on animals conducted in the 1960 s in fact showed unfavorable results using the treatment for heart disease A closer look at the studies however reveals that they were performed on anesthetized dogs laying helplessly on a table with various tubes running in and out of them These animals were given drugs to induce some type of heart malfunction then hyperbaric oxygen was administered usually at far too high a pressure for either too long or too short a time Such procedures on animals don t translate neatly into the human condition The human patient can alter his or her risk factors by improving diet stopping smoking increasing exercise and doing those various other beneficial things that I ve mentioned Definitely chelation therapy taken along with the HBO received at the proper pressure for the time needed to effect heart disease reversal is the ideal way to go Retaining risk factors is ridiculous but that was done in experiments with the anesthetized dogs Such experiments were fated for failure and did fail Still the studies were reported in the clinical journals and threw off physician readers from following the correct path as regarding the use of hyperbaric oxygen as therapy for angina myocardial infarction and other heart ailments As we have stated very little oxygen is dissolved in blood plasma at the normal atmospheric pressure of 102 millimeters of mercury mm Hg HBO therapy forcefully puts oxygen unbound by hemoglobin into the blood plasma This increases the blood oxygen level fourteen times to 1433 mm Hg and thereby delivers much greater quantities of oxygen to oxygen starved tissues Those organs tissues and cells that have been suffering from a lack of oxygen because of poor circulation or damage then will become revitalized and begin to function more effectively The London Westminster Hospital Experience with HBOT In London C J Gavey MD chief of the cardiac department at Westminster Hospital pressurized heart attack patients to save their lives For four days He subjected them to 2 ATA in 100 percent oxygen for two hours followed by a rest of one hour in plain air and then continued the cycle of two hours in the chamber and one hour out His idea was to send oxygen through the unblocked blood vessels to the ischemic tissues at the edge of the infarct area preventing the impending death of additional heart muscle He figured that this procedure might avoid the triggering of fatal arrhythmias Forty men and women who had suffered serious heart attacks within twenty four hours were treated this way by Dr Gavey They ranged in age from thirty five to seventy two years Surviving their cardiovascular accidents as a result of undergoing the HBO procedure directly upon their admittance to London s Westminster Hospital were 92 5 percent of the acutely affected patients Of these thirty seven initial survivors three died within fifteen days giving a final survival rate of 85 percent

Page 49

Quite significant was the reduction of heart pain experienced by these patients Almost a quarter century before Dr Myrv in Ellestad made his AHA conference presentation Dr Gavey reports that twenty three of his patients arrived in severe pain and fourteen had difficulty breathing Once settled into the pressure chamber none of the patients felt any more pain Within thirty minutes of pressurization their breathing problems eased too Inasmuch as only the really critical cases those who potentially could die on the spot have been administered HBO such results were quite heartening to the Westminster Hospital authorities They considered that HBO therapy saved some patients from fatal cardiogenic shock The optimum hyperbaric regimen for cardiac conditions however was not defined and was still being decided upon twenty five years after Dr Gavey s clinical experiment Dr Ellestad confirmed Dr Gavey s report How Strange It Is That Cardiologists Don t Prescribe HBOT If heart disease allows insufficient oxygen to get into the heart muscle as stated earlier various symptoms that most of us can identify must result With O2 being inhaled at normal atmospheric pressure but not preventing cardiovascular problems for the more than 1 200 000 heart attack victims each year in the United States alone obviously greater amounts of this life giving element must be obtained HBO administered at the established two atmospheres absolute to force O2 into the body allows the doctor to effect 4 3 ml of oxygen being dissolved into each 100 ml of blood Thus a cardiologist or other doctor is furnishing therapeutic oxygen amounting to a fourteenfold increase Simply this is Henry s gas law of physics at work Using modern equipment in this way any skilled physician can safely elevate available oxygen for his patient to provide pain relief to prevent fatal arrhythmias or shock and to allow time for collateral blood circulation to develop Yet HBO seldom is used in the U S to reverse heart disease before it becomes near fatal Isn t it strange that cardiologists don t routinely utilize hyperbaric oxygen as a valid therapy Even odder is that they almost never employ the modality to benefit their cardiac patients at all That s because the average American allopathic physician traditionally trained primarily in the use of drugs and surgery usually fails to have access to and certainly does not personally own a hyperbaric chamber Moreover the doctor probably is unfamiliar with what taking oxygen under pressure can do for promoting human homeostasis We have a most peculiar conundrum here for which the answer would be funny if we were not dealing with matters of life and death Note the irony Of the hundreds of published scientific studies applied to heart disease the set of elements you will seldom read or hear about is the mention of diet exercise smoking and drinking habits of the cardiac patient in conjunction with administering HBOT to him or her This is a commonsense procedure the use of hyperbaric oxygen with one s everyday healthy lifestyle Instead detailed instructions usually are given only for the various drugs being tested with HBO Combining hyperbaric oxygen with those other more vital factors involving lifestyle poor lifestyle practices probably being the source of heart weakness or disease in the first place could optimize the outcome for an involved cardiac patient Reprinted with Permission Research References 1 2 Dmitrieva E M et al Hyperbaric oxygenation in experimental therapy of acute regional hypoxia of the myocardium and brain In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 276 277 Glants B R Therapeutic effects of mercazol in combination with hyperbaric oxygenation in the treatment of acute myocardial hypoxia In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 275

Page 50

3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Kogan A H et al The question of the use of antioxidants beta adrenergic blockers and cardiac glycosides in oxygen therapy of acute myocardial infarction In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 275 276 Yefuni S N et al The use of hyperbaric oxygenation in combined therapy of acute myocardial infarction In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 264 265 Zamotaev I P et al Hyperbaric oxygenation in the treatment of ischemic heart disease and peptic ulcer of stomach and duodenum In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 269 Op Cit Yefuni S N Kolomeitseva S P et al Hyperbaric oxygenation as an adjunct in the treatment of ischemic heart disease In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 266 Kuleschova M R et al Physical rehabilitation of patients with ischemic heart disease using hyperbaric oxygenation In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 268 269 Golyakov V N et al Hemostasis in patients with ischemic heart disease during hyperbaric oxygenation Klin Med Mosk 64 2 92 95 1986 Borukhov S A et al HBO effect on clinico biochemical blood indexes in patients with ischemic heart disease In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 271 272 Ashfield R et al Severe acute myocardial infarction treated with hyperbaric oxygen Report on forty patients Postgrad Med J 45 648 654 October 1969 Op Cit Borukhov S A Ibid Isakov Y V et al Hyperbaric oxygenation in combined treatment of paroxysmal tachyarrhythmias in ischemic heart disease Kardiologiia 21 4 42 45 April 1981 Ivleva V I et al Effect of hyperbaric oxygenation on the activity of the sympathoadrenal and Kallikrein Kinin systems of blood in some disorders of cardiac rhythm Ter Arkh 53 5 66 68 1981 Malinovsky N N et al The use of hyperbaric oxygenation in cardiac arrhythmia In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 284 285 Timchuk I D et al Hyperbaric oxygenation in complex treatment of patients with disorders of rhythm and conduction of heart In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 286 Op Cit Kolomeitseva S P Kulkybaev G A et al Functional state of the cardiovascular system and lungs of patients with chronic ischemic heart disease under conditions of hyperbaric oxygenation In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 269 270 Kostyukov V V et al Coronary circulation and oxygen regime of the myocardium at a low cardiac output and HBO In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 276 Rugenyus Y Y et al The effect of hyperbaric oxygenation on the conductive system of the heart in patients with ischemic heart disease In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 p 271 Zhumanov K D et al A study on metabolic indexes in patients with chronic ischemic heart disease subjected to hyperbaric oxygenation In Abstracts VII Int Cong HBO Medicine Moscow Sept 2 6 1981 pp 270 271 Op Cit Ashfield R Hyperbaric unit puts pressure on heart deaths Medical World News May 24 1968 Tufano R et al Hyperbaric oxygen effects on pain relief in patients with vascular disease J Hyperbaric Medicine Vol 3 No 1 1988 Visona A et al Hyperbaric oxygenation in the treatment of peripheral vascular disease J Hyperbaric Medicine Vol 2 No 4 1987 Trimble V H The Uncertain Miracle Hyperbaric Oxygenation Garden City NY Doubleday 1974 pp 124 127

Page 51

Page 52

September 1998 and it is still in progress This is a preliminary report The first group included 6 patients with CAD stable angina pectoris I III class NYHA and receiving usual treatment Patient were pressurized during 15 20 minute period up to 1 5 atmosphere absolute pressure aap and remained at this pressure for 40 minutes and then depressurized during 15 minute period to normal atmosphere pressure Total time of HBOT was 70 80 minutes In the control group these 6 patients stayed in HBOT chamber under 1 0 aap in the 21 40 oxygen s atmosphere instead first 7th and 11th HBOT sessions during 70 80 minutes We used monoplace chamber OKA MT with 1m3 volume inside Monitoring of electrocardiogram ECG noninvasive blood pressure before and after HBOT in supine position was performed during HBOT sessions Every patient received 10 HBOT sessions in the same time every day HRV was calculated in general agreement with the standards of measurement proposed by Task Force of the European Society of Cardiology and the North American Society of Pacing and Electrophysiology 1 The HRV was recorded using computer based electrocardiograph system Cardiolab 2000 during sessions 2 6 and 10 before HBOT on the first minute under the 1 5 aap and on 40th minute under 1 5 aap In the control group the HRV was recorded before HBOT on 15 and 55 minutes of the sessions 1 7 and 11 HRV was analyzed on 5 minute period of stable ECG recording for the frequency domain measures with the use of fast Fourier transform We measured the total power TP of the R R interval 0 0 5 Hz The frequency ranges were subdivided into 0 03 0 15 Hz as a low frequency component LF and 0 15 0 5 Hz as a high frequency HF one TP LF HF was expressed in absolute values ms2 We measured also the LF HF ratio and LF and HF in normalized units LFn HFn respectively calculated as a percentage of TP of the R R interval from which the power of any component with a frequency of less than 0 03 Hz was removed 1 The results are given as mean standard deviation SD A p value

Page 53

Our preliminary results showed that measurement of HRV was helpful in monitoring during the sessions of HBOT and reflected the effects in the treatment of patients with CAD Adjunctive HBOT can improve prognosis in patients with CAD Based on values of HRV it will be possible in the future to modulate the protocols of HBOT Of course it need to explore the influence of other treatment protocols of HBOT on ANS and in particularly how long changes we detected last In Figure 1 and 2 showed changes in Very LF component that reflected another ways to change HRV but it will be another report The authors wish to thanks the Callahan s and Ockunzzi s family Cleveland Ohio USA for assistance References 1 2 3 4 5 6 7 8 9 10 11 12 13 Task Force of the European Sosiety of Cardiology and the North American Sosiety of Pacing and Electrophysiology Heart Rate Variability Standards of Measurements physiological interpretation and clinical use Circulation 1996 V 93 1043 1065 Ackerman NB Brinkly FB Oxygen tension in normal and ischemic tissues during hyperbaric treatment JAMA 1966 198 1280 3 Kawamura M Sakakibara K Sakakibara B et al Protective effect of hyperbaric oxygen for temporary ischemic myocardium macroscopic and histologic data Cardiovasc Res 1976 10 599 604 Adrian H Shandling MD Myrvin H Ellestad MD et al Hyperbaric oxygen and thrombolysis in myocardial infarction The HOT MI Pilot Study Am Heart J 134 3 544 550 1997 Seriakov VV Feofanova ID Hyperbaric oxygenation and antiaggregants effects on platelet function in patients with ischemic heart disease Anesteziologiia i Reanimatologiia 2 31 3 1997 Mar Apr Maria Vittoria Pitzalis Filippo Mastropasqua et al Assesment of cardiac vagal activity in patient with hyperthyroidism International Journal of Cardiology 64 1998 145 151 Simonetta Scavini Maurizio Volterrani Emanuela Zanelli et al International Journal of Cardiology 67 1998 9 17 Andrew J Burger MD and Masoor Kamalesh MD Effect of Beta Adrenergic Blocer Therapy on the Circadian Rhythm of Heart Rate Variability in Patients with Chronic Stable Angina Pectoris The American Journal of Cardiology vol 83 February 15 1999 Amara C E and Wolfe L A Reliability of Noninvasive Methods to Measure Cardiac Autonomic Function Can J Appl Physiol 23 4 396 408 1998 P J Schwartz The autonomic nervous system and sudden death European Heart Journal 1998 19 Supplement F F72 F80 Nolan James MD Batin Phillip D MD Andrews Richard MRCP et al Prospective Study of Heart Rate Variability and Mortality in Chronic Heart Failure Results of the United Kingdom Heart Failure Evaluation and Assesment of Risk Trial UK Heart Circulation Vol 98 15 October 13 1998 1510 1516 Singh Jagmeet P MD Dphil Larson Martin G ScD O Donnell Christopher J MD MPH et al Circulation Vol 99 17 May 4 1999 2251 2254 Ad Van Boven MD J Wouter Jukema MD Jaap Haaksma BSc Depressed heart rate variability is associated with events in patients with stable coronary artery disease and preservsd left ventricular function American heart Journal Vol 135 Number 4 571 575 Hyperbaric oxygen limits infarct size in ischemic rabbit myocardium in vivo Sterling DL Thornton JD Swafford A Gottlieb SF Bishop SP Stanley AW Downey JM Department of Biological Sciences University of South Alabama Mobile 36688

Page 54

BACKGROUND We explored the ability of increased oxygen pressure to modify necrosis in an open chest rabbit model of myocardial ischemia and reperfusion METHODS AND RESULTS A branch of the left coronary artery was occluded for 30 minutes followed by 3 hours of reperfusion Infarction was measured by triphenyl tetrazolium staining and expressed as a percentage of the ischemic zone Untreated rabbits were ventilated with 100 oxygen at 1 atm absolute Treatment animals were exposed to hyperbaric oxygen at 2 5 atm absolute The 1 0 atm control hearts developed 41 5 4 6 infarction of the ischemic zone Animals exposed to hyperbaric oxygen during ischemia only reperfusion only or ischemia and reperfusion had significantly smaller infarcts with respect to control animals 16 2 2 9 14 5 3 7 and 9 8 2 7 respectively P or 01 indicating that they had been protected by the procedure When hyperbaric oxygen was begun 30 minutes after the onset of reperfusion no protection was seen 35 8 3 8 CONCLUSIONS We conclude that hyperbaric oxygen limits infarct size in the reperfused rabbit heart and that the effect can be achieved when hyperbaric oxygen is begun at reperfusion Atorvastatin decreases the coenzyme Q10 level in the blood of patients at risk for cardiovascular disease and stroke Arch Neurol 2004 Jun 61 6 889 92 Rundek T Naini A Sacco R Coates K DiMauro S Department of Neurology Columbia University College of Physicians Surgeons New York NY 10032 USA BACKGROUND Statins 3 hydroxy 3 methylglutaryl coenzyme A reductase inhibitors are widely used for the treatment of hypercholesterolemia and coronary heart disease and for the prevention of stroke There have been various adverse effects most commonly affecting muscle and ranging from myalgia to rhabdomyolysis These adverse effects may be due to a coenzyme Q 10 CoQ 10 deficiency because inhibition of cholesterol biosynthesis also inhibits the synthesis of CoQ 10 OBJECTIVE To measure CoQ 10 levels in blood from hypercholesterolemic subjects before and after exposure to atorvastatin calcium 80 mg d for 14 and 30 days DESIGN Prospective blinded study of the effects of short term exposure to atorvastatin on blood levels of CoQ 10 SETTING Stroke center at an academic tertiary care hospital Patients We examined a cohort of 34 subjects eligible for statin treatment according to National Cholesterol Education Program Adult Treatment Panel III criteria RESULTS The mean SD blood concentration of CoQ 10 was 1 26 0 47 micro g mL at baseline and decreased to 0 62 0 39 micro g mL after 30 days of atorvastatin therapy P

Page 55

Adjunctive effect of hyperbaric oxygen treatment after thrombolysis on left ventricular function in patients with acute myocardial infarction October 2004 Volume 148 Number 4 Milica Dekleva MD PhDAleksandar Neskovic MD PhD FESC Alja Vlahovic MD Biljana Putnikovic MD PhD Branko Beleslin MD FESC Miodrag Ostojic MD PhD FESC FACC Cardic Abstract Background The role of hyperbaric oxygen in patients with acute myocardial infarction is controversial ranging from not beneficial to having a favorable effect This randomized study was conducted to further assess the benefit of hyperbaric oxygen treatment after thrombolysis on left ventricular function and remodeling in patients with acute myocardial infarction Methods Seventy four consecutive patients with first acute myocardial infarction were randomly assigned to treatment with hyperbaric oxygen treatment combined with streptokinase HBO or streptokinase alone HBO Results There was a significant decrease of end systolic volume index from the first day to the third week in HBO patients compared with HBO patients from 30 40 to 28 18 vs from 30 89 to 36 68 mL m2 P 05 accompanied with no changes of end diastolic volume index in HBO compared with increased values in HBO from 55 68 to 55 10 vs from 55 87 to 63 82 mL m2 P 05 Ejection fraction significantly improved in the HBO group and decreased in the HBO group of patients after 3 weeks of acute myocardial infarction from 46 27 to 50 81 vs from 45 54 to 44 05 P 05 Conclusions Adjunctive hyperbaric oxygen therapy after thrombolysis in acute myocardial infarction has a favorable effect on left ventricular systolic function and the remodeling process Researchers Find More Than 10 of Heart Failure Patients Have Mental Disorder Comorbidities Presented at HFSA Researchers Find More Than 10 of Heart Failure Patients Have Mental Disorder Comorbidities Presented at HFSA By Ed Susman BOCA RATON FL September 23 2005 More than 10 of heart failure patients also have mental disorder comorbidities reported researchers here at the 9 th annual scientific meeting of the Heart Failure Society of America HFSA There is growing recognition of the high prevalence of depression and impaired cognition in persons with heart failure but little attention has been given to other comorbid mental disorders said Steven Sayers PHD Assistant Professor of Psychiatry University of Pennsylvania Philadelphia Pennsylvania United States Mental disorders may interfere with self care in heart failure patients and contribute to poor outcomes

Page 56

To determine the rate of comorbid mental disorders among Medicare patients who were hospitalized for HF Dr Sayers and colleagues examined a 5 sample of Medicare records He presented the results of that examination on September 20th Of 13 169 patients with HF identified in that sample the database indicated that about 1556 11 8 patients had comorbid mental disorders Depression accounted for 52 8 of patients with mental disorders 22 had anxiety disorders and 16 7 had psychoses Alcohol abuse was identified in 16 3 of patients with heart failure and comorbid mental disorders Comorbid depression and psychoses appear to be associated with longer hospitalizations almost 3 days more he said All patients with comorbid mental disorders tended to have more annual hospitalizations than patients with heart failure who did not have mental disorders He said that his analysis shows that while patients with comorbid mental disorders tend to use more resources except for patients with psychoses there are no increased mortality risks Patients with alcohol abuse disorder did not increase costs associated with their hospitalizations he said It is likely that the actual rates of psychiatric comorbidity in this sample are higher than the rates we estimated from administrative data due to common problems of underdetection and underdocumentation of mental disorders Dr Sayers noted He suggested that this type of comorbidity may represent an important addressable source of increased costs of healthcare for patients with heart failure Presentation title Comorbid Mental Disorder among Patients Hospitalized with Heart Failure Abstract 283 German Study Links Infection Heart Disease By Maggie Fox Health and Science Correspondent WASHINGTON Reuters Researchers in Germany said on Monday they had found more evidence that infections with bacteria that cause pneumonia ear infections and other diseases may also cause heart disease The study in the American Heart Association journal Circulation adds to a growing body of evidence that the body s response to some infections may help cause heart disease We showed a significant association between the number of infections to which a patient has been exposed and the extent of atherosclerosis in the arteries in the heart neck and legs Dr Hans Rupprecht and Dr Christine Espinola Klein of Johannes Gutenberg University in Mainz Germany who conducted the study said in a statement The risk for death was increased by the number of infectious agents especially in people with advanced artery disease Researchers believe it is the body s inflammatory response to an infection that helps along with a fatty diet to clog arteries The plaques that form these clogs are created when immune system cells latch onto fat cells in the blood and try to pull them out through the cell wall The fat cell is often too big and it gets caught Thetrapped immune and fat cells build up in the artery wall harden and can block blood flow or break off into clots

Page 57

Inflammatory responses to infection can send more of these immune cells circulating looking for something to do Rupprecht s team tested 572 patients with heart disease most of whom had chest pain or heart attack EIGHT MICROBES ASSOCIATED WITH HEART DEATH They looked herpes simplex virus 1 and 2 which cause cold sores and genital herpes cytomegalovirus which is another herpes virus Epstein Barr virus which causes mononucleosis Hemophilus influenzae a bacteria that causes ear and upper respiratory infections Chlamydia pneumoniae which can cause pneumonia Mycoplasma pneumoniae another cause of pneumonia and Helicobacter pylori which causes most stomach ulcers Over the next three years Rupprecht s team wrote they found a clear correlation between how many infections a person had and his or her risk of dying from heart disease The antibody titers levels for C pneumoniae H pylori H influenzae cytomegalovirus and herpes simplex virus type 2 were related to the extent of atherosclerosis Espinola Klein said in an interview conducted by e mail In patients who tested positive for up to three infections the death rate was 3 1 percent The death rate was 9 8 percent for those infected with four to five agents and 15 percent for those with six to eight pathogens Twenty percent of the patients with advanced atherosclerosis who had six to eight infections died compared to 7 percent of those with three exposures or fewer Based on these results we think that the number of infections to which an individual has been exposed may be involved in the development and progress of atherosclerosis Both bacterial and viral pathogens seem to be involved Espinola Klein said But Dr Paul Ridker director of the Center for Cardiovascular Disease Prevention at Brigham and Women s Hospital in Boston said the link may not necessarily mean that infections cause heart disease They could just be a marker for something else For example Ridker said in a commentary people with a lot of infections could be in poorer health in general Ridker who also studies links between infection and heart disease has found that healthy people with high levels of inflammatory cells are more likely to develop heart disease Our results suggested that inflammation seems to be a fundamental issue he said and noted that other studies indicate that aspirin and cholesterol lowering statin drugs may prevent heart disease at least in part by reducing inflammation Last November a Swedish team reported in the Journal of the American Medical Association that elevated levels of interleukin 6 one of the body s inflammatory signaling chemicals could predict deaths from heart disease And last February an Austrian team reported that people who get infections over and over again such as sinus infections or bronchitis may also be more prone to clogged arteries But although several studies have linked infection with heart disease none has shown that people who took antibiotics had a lower risk of heart disease

Page 58

Cardiovascular Revascularization Medicine 11 2010 8 19 Hyperbaric oxygen preconditioning improves myocardial function reduces length of intensive care stay and limits complications post coronary artery bypass graft surgery Jeysen Zivan Yogaratnam a Gerard Laden b Levant Guvendik a Mike Cowen a Alex Cale a Steve Griffin a a Department of Cardiothoracic Surgery Castle Hill Hospital Castle Road HU16 JQ Cottingham United Kingdom North of England Hyperbaric and Medical Services Classic Hospital Lowfield Road Anlaby East Yorkshire HU10 7AZ United Kingdom b Received 31 December 2008 received in revised form 16 March 2009 accepted 17 March 2009 Abstract Objective The objective of this study was to determine whether preconditioning coronary artery disease CAD patients with HBO2 prior to first time elective on pump cardiopulmonary bypass CPB coronary artery bypass graft surgery CABG leads to improved myocardial left ventricular stroke work LVSW post CABG The primary end point of this study was to demonstrate that preconditioning CAD patients with HBO2 prior to on pump CPB CABG leads to a statistically significant Pb 05 improvement in myocardial LVSW 24 h post CABG Methods This randomised control study consisted of 81 control group 40 HBO2 group 41 patients who had CABG using CPB Only the HBO2 group received HBO2 preconditioning for two 30 min intervals separated 5 min apart HBO2 treatment consisted of 100 oxygen at 2 4 ATA Pulmonary artery catheters were used to obtain perioperative hemodynamic measurements All routine perioperative clinical outcomes were recorded Venous blood was taken pre HBO2 post HBO2 HBO2 group only and during the perioperative period for analysis of troponin T Results Prior to CPB the HBO2 group had significantly lower pulmonary vascular resistance P 03 Post CPB the HBO2 group had increased stroke volume P 01 and LVSW P 005 Following CABG there was a smaller rise in troponin T in HBO2 group suggesting that HBO2 preconditioning prior to CABG leads to less postoperative myocardial injury Post CABG patients in the HBO2 group had an 18 P 05 reduction in length of stay in the intensive care unit ICU Intraoperatively the HBO2 group had a 57 reduction in intraoperative blood loss P 02 Postoperatively the HBO2 group had a reduction in blood loss 11 6 blood transfusion 34 low cardiac output syndrome 10 4 inotrope use 8 atrial fibrillation 11 pulmonary complications 12 7 and wound infections 7 6 Patients in the HBO2 group saved US 116 49 per ICU hour Conclusion This study met its primary end point and demonstrated that preconditioning CAD patients with HBO2 prior to on pump CPB CABG was capable of improving LVSW Additionally this study also showed that HBO2 preconditioning prior to CABG reduced Clinical Trial registration information URL http clinicaltrials gov ct2 show NCT00623142 term hyperbaric oxygen rank 1 Unique identifier NCT00623142 Funding source Centre of Medical Excellence Air Products Global Healthcare Avda Tenerife 2 28703 Madrid Spain Tel 34 629254357 Contact Bego a Se or M D Contact e mail senorccb apci com Project Code Number RD 06 0245 Corresponding author 2 Annandale Road W4 2HF London UK Tel 44 7974214691 E mail address jeysenzy msn com J Z Yogaratnam 1553 8389 09 see front matter 2010 Elsevier Inc All rights reserved doi 10 1016 j carrev 2009 03 004

Page 59

J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 9 myocardial injury intraoperative blood loss ICU length of stay postoperative complications and saved on cost post CABG 2010 Elsevier Inc All rights reserved Keywords Hyperbaric oxygen Ischemic reperfusion injury CABG 1 Introduction Hyperbaric means relating to producing operating or occurring at pressures higher than normal atmospheric pressure 1 In hyperbaric oxygen HBO2 therapy the patient breaths pure oxygen 100 at a pressure greater than atmospheric pressure while in a steel or polymer chamber HBO2 therapy is known mainly for its use as the treatment of choice in carbon monoxide poisoning gas embolism and decompression sickness The experience of hyperbaric medicine specialist and to a certain extent the scientific literature also support the use of HBO2 as an adjuvant treatment for a number of other medical conditions such as complex refractory wounds 2 intracranial abscess radiation tissue injury crush injuries compartment syndrome acute traumatic peripheral ischemia burns and other tissue damage resulting from ischemic reperfusion injury IRI 3 At present there are no standard protocols for specific medical conditions The therapeutic procedures vary according to the condition acute or chronic and the treatment centre The treatment can be administered on a one time basis and varies in duration by way of several daily or twice daily sessions of predetermined duration The pressure at which HBO2 is administered depends on several factors such as the medical condition the patient s characteristics the type of chamber and the centre s practices Hyperbaric oxygen results in an oxidative stress that is capable of increasing reactive oxygen species ROS generation 4 6 It has been previously suggested that part of the therapeutic effect of HBO2 may originate from the generation of ROS 7 and that this ROS initiates a cascade of events that may lead to myocardial protection This is paradoxical to the traditional premise that ROS plays an important role in IRI mediated cellular damage 8 9 In a study involving IRI conducted by Sterling et al 10 it was demonstrated that the animals exposed to HBO2 during ischemia only reperfusion only or ischemia and reperfusion had significantly smaller myocardial infarct sizes compared to the control animals indicating they had been protected by HBO2 This study suggested that HBO2 compared to normobaric hyperoxia was capable of inducing myocardial protection Furthermore it also provided one of the first experimental evidences that pretreatment with HBO2 also known as HBO2 preconditioning prior to a reperfusion injury was capable of inducing myocardial protection The specific ability for HBO2 preconditioning prior to IRI to reduce myocardial infarct size in animals has also more recently been demonstrated by Kim et al 11 and Han et al 12 The work by Kim et al 11 furthermore suggests that part of the protective effect of HBO2 preconditioning may involve ROS and its effects on antioxidants Moreover it has also been suggested 7 13 that the cellular protective effects of HBO2 may stem from production of nitric oxide synthase NOS and heat shock proteins Hsp Both NOS 14 and Hsp 15 are known to be cardioprotective and have been shown to be induced by ROS 16 17 thus implicating their possible roles in HBO2 induced myocardial protection via ROS In the Hyperbaric Oxygen Therapy in Percutaneous Coronary Intervention HOT PI study 18 following stabilization with medical therapy resolution of chest pain and normalization of ST segment changes patients who presented with unstable angina or acute myocardial infarction AMI were randomized to a group treated with HBO2 or a group which was not treated with HBO2 The results demonstrated that patients who received adjunctive HBO2 in the early peri percutaneous coronary intervention period had a lower clinical restenosis rate Significantly fewer patients Pb 003 in the HBO2 group required revascularization of the target lesion and the number of patients with recurrence of late angina symptoms was also less frequent Pb 05 in this group In addition composite adverse cardiac events death myocardial infarction coronary artery bypass graft surgery CABG or revascularization of target lesion at 8 months were significantly higher in the control group compared to the HBO2 group P 001 The results of this study also suggest that HBO2 preconditioning may have the capacity to reduce vascular ischemic events by perhaps limiting the pathological progression of atherosclerosis This concept has been corroborated by animal findings 19 20 demonstrating that HBO2 treatment halted the progress of atherosclerosis and appeared to facilitate it regression In the Hyperbaric Oxygen Therapy in Myocardial Infarction HOT MI study 21 patients with an AMI who received recombinant tissue plasminogen activator rTPA were randomized to treatment consisting of HBO2 combined with rTPA or rTPA alone In this study the group that was also treated with HBO2 experienced an improvement in post MI ejection fraction a 35 reduction in mean creatinine phosphokinase CK at 12 and 24 h post MI a reduction in time to pain relief and ST segment resolution post MI The authors of this study concluded by suggesting that adjunctive HBO2 was a feasible and safe treatment for AMI Based on the available clinical evidence 18 21 the hypothesis of this clinical study was that HBO2 preconditioning in patients with CAD prior to first time elective on

Page 60

10 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 pump cardiopulmonary bypass CPB CABG would be capable of improving myocardial function The objective of this study was to determine whether preconditioning CAD patients with HBO2 prior to first time elective on pump CPB CABG leads to improved myocardial left ventricular stroke work LVSW post CABG The primary end point of this study was to demonstrate that preconditioning CAD patients with HBO2 prior to onpump CPB CABG leads to a statistically significant Pb 05 improvement in myocardial LVSW 24 h post CABG The secondary end points of this study were to assess the effects of HBO2 preconditioning on a the other measured parameters of cardiovascular hemodynamics which included i Heart rate HR ii Mean arterial pressure MAP iii Stroke volume SV iv Cardiac output CO v Cardiac index CI vi Mean pulmonary artery pressure MPAP vii Pulmonary capillary wedge pressure PCWP viii Pulmonary vascular resistance PVR ix Pulmonary vascular resistance index PVRI x Systemic vascular resistance SVR xi Systemic vascular resistance index SVRI xii Left ventricular stroke work LVSW xiii Left ventricular stroke work index LVSWI xiv Right ventricular stroke Work RVSW xv Right ventricular stroke work index RVSWI b serum troponin T c myocardial NOS and Hsp d serum soluble adhesion molecules sPSGL 1 sP selectin sE selectin sICAM 1 e post CABG length of intensive care unit ICU stay f the incidence of the following post CABG complications i low cardiac output syndrome defined as difficulty in maintaining intra and postoperative mean arterial pressure above 70 mmHg ii inotrope usage iii atrial fibrillation iv intra and postoperative blood loss v postoperative blood transfusion vi pulmonary renal gastrointestinal and neurological complications vii infections viii perioperative MI ix reoperations for bleeding x mortality A post hoc analysis was also done to determine the costeffectiveness of HBO2 preconditioning in this study This article will focus on the primary end point and all the secondary end points apart from the serum adhesion molecules and the myocardial NOS and Hsp which will be reported on later 2 Methods and materials 2 1 Research approval study design and statistical analysis Prior to commencing this study ethical and hospital approval was obtained from the Hull and East Riding Local Research Ethics Committee approval number 04 Q1104 26 and the Hull and East Yorkshire NHS Trust approval number R0047 respectively This study is registered on ClinicalTrials gov http clinicaltrials gov ct2 show NCT00623142 term hyperbaric oxygen rank 1 with the registration number NCT00623142 and conforms with the Declaration of Helsinki Sample size calculations were based on detecting differences between treatment groups in the percentage change of LVSWI from initial to final measurement points as was done in another study involving pharmacological preconditioning and myocardial protection 22 Based on a previous clinical study 23 involving HBO2 and CABG a within group standard deviation of 6 25 was assumed A two sided 5 significance level and a 90 power were specified Allowing for a 7 5 detection of an interaction between the two possible treatment combinations and allowing for increased variance of interaction and estimates relative to the main effect 24 it was determined that a minimum of 60 patients would be required to show statistical significance Patients were randomised by pulling out sealed envelopes in sequence from a box The random treatment allocations were contained within the envelope The random treatment allocation list was prepared by the study statistician Repeated measures ANOVA was used to analyse the hemodynamic data clinical outcomes and perioperative serum troponin T Data were analysed in accordance with the principles of intention to treat ITT basis 25 26 Where data were missing no imputation of data was done Where the data were skewed log transformation was performed to normalise the data for statistical analysis Where relevant data from logged results were transformed back into original estimates as the geometric mean of the ratio of the HBO2 group to control group values 27 2 2 Patient selection From January 2005 to July 2006 774 consecutive patients were admitted to the hospital for first time elective CABG surgery with the use of CPB From this cohort of patients 81 matched the study criteria The inclusion criteria were a patients undergoing first time elective CABG surgery using CPB The exclusion criteria were b age b20 and N85 years c ejection fraction b30

Page 61

J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 d unstable angina e 1 month post myocardial infarction f cardiac disease other than coronary artery disease CAD g organ failure h history of chronic obstructive pulmonary disease COPD pneumothorax pulmonary bullae convulsions malignancy myopia or intraocular lens i current use of K ATP channel openers oral hypoglycemics opioid analgesics or catecholamines 2 3 Randomisation Of the 81 fully informed patients who volunteered and consented to participate in this study 40 were randomised to the control group not receiving HBO2 preconditioning and 41 were randomised to the HBO2 preconditioning group In this study the patients were aware of their randomisation groups but none of the surgeons anaesthetist perfusionists or nursing team was aware of the treatment allocation groupings of the study patients Following randomisation 11 there were five drop outs from the control group and seven from the HBO2 group Fig 1 shows the CONSORT flow diagram of patients recruited to this study 2 4 Hyperbaric oxygen preconditioning protocol The pressure and duration for HBO2 preconditioning were based on the optimum effect noted in a previous clinical study 23 On the morning prior to CABG patients randomised to the HBO2 group were treated with HBO2 The HBO2 preconditioning treatment consisted of pressurisations over 10 min from 1 to 2 4 ATA During this pressurisation period the patients were breathing air Once at 2 4 ATA patients placed a clear plastic hood over their heads One hundred percent oxygen was supplied into this hood which the patients breathe for 30 min This period was followed by a 5min interval out of the hood at 2 4 ATA During this period out of the hood patients were only breathing air After this interval the hood was placed on again for a further 30 min and the patients again breathe 100 oxygen at 2 4 ATA Subsequent to this the hood was removed again and the Fig 1 Consort flow diagram of study

Page 62

12 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 chamber is depressurised over 25 min back to 1 ATA During this depressurisation period patients were again only breathing air Treatment with HBO2 preconditioning was completed approximately 4 h prior to CPB 2 5 Surgical protocol There were two surgeons and seven anaesthetists who were part of this single centre randomised control study All of them adhered to the same surgical technique Intermittent cross clamp fibrillatory arrest was used as means of intraoperative myocardial protection A Stockert SIII roller pump Stockert Instrumente Germany with a hollow fibre membrane oxygenator and an integral hard shell venous cardiotomy reservoir Avant Phisio M Dideco Italy was used for CPB together with a 38 m arterial line filter Affinity352 Medtronic USA Moderate systemic hypothermia of 32 C was maintained during CPB Rewarming of the patient was commenced during the distal anastomosis of the final CABG 2 6 Hemodynamic monitoring In order to monitor hemodynamic parameters a pulmonary artery PA catheter Edward Life Sciences Germany was inserted following anaesthetic induction Hemodynamic parameters were measured post anaesthetic induction 5 min post CPB and 2 4 8 12 and 24 h post CPB The hemodynamic parameters that were measured were HR MAP SV CO CI MPAP PCWP PVR PVRI SVR SVRI LVSW LVSWI RVSW and RVSWI 2 7 Venous blood sampling Venous blood was taken pre HBO2 preconditioning from all patients in the HBO2 group At this same time point a venous blood sample was also taken from all patients in the control group Further venous blood samples were taken within 1 h post HBO2 preconditioning HBO2 group only 5 min following the onset of CPB both groups 5 min post IRI following the final period of clamping and unclamping of the aorta both groups 2 h post CPB both groups and 24 h post CPB both groups The blood was collected into a yellow top BD Vacutainer Tube SST ll Advance and used to analyse the presence of serum troponin T This analysis was done by the Department of Biochemistry at the Hull and East Yorkshire NHS Trust within 4 h of collection using an immunochemiluminescent sandwich assay performed on the Roche Elecsys 2010 analyser Roche Diagnostics Germany in accordance with the manufacturer s recommendations 3 Results Table 1 shows the perioperative data of the patients recruited to this study In this study patient ages and gender Table 1 Comparison of perioperative factors Variable Age Men BMI Preoperative Euroscore Unstable angina Previous MI Left main stem disease One diseased coronary artery Two diseased coronary arteries Three diseased coronary arteries Left ventricular function 50 30 50 Hypertension Diabetes mellitus Peripheral vascular disease CABG 1 CABG 2 CABG 3 CABG 4 CABG 5 Myocardial ischemia time min Cardiopulmonary bypass time min Control group n 40 HBO2 group n 41 68 8 29 72 5 28 8 3 78 1 95 3 7 5 20 51 3 13 32 5 0 0 64 7 33 80 5 28 2 2 83 1 88 1 2 5 16 41 0 13 31 7 1 2 4 7 17 5 8 19 5 33 82 5 32 78 0 31 79 5 7 17 9 30 75 0 5 12 5 1 2 5 1 2 5 13 32 5 20 50 0 5 12 5 1 2 5 29 2 33 82 5 7 17 5 25 62 5 3 7 5 3 7 5 2 5 0 13 32 5 22 55 0 3 7 5 0 0 27 6 65 8 62 5 Values are means except when otherwise labelled between the groups were similar The control group had a slightly higher mean preoperative risk score with a mean preoperative Euroscore of 3 78 while the HBO2 group had a mean preoperative Euroscore of 2 83 The control group had a higher number of diabetic patients n 5 12 5 compared to the HBO2 group n 3 7 5 There were more patients with peripheral vascular disease in the HBO2 group n 3 7 5 than in the control group n 1 2 5 The majority of patients in the control group and HBO2 group had CABG 3 50 vs 55 More patients in the HBO2 group had CABG 1 n 2 5 vs n 1 2 5 and CABG 3 n 22 55 vs n 20 50 compared to the control group However the control group had more patients who had CABG 4 n 5 12 5 vs n 3 7 5 The control group had a slightly longer mean myocardial ischemic time 29 2 vs 27 6 min and a slightly longer CPB time 65 8 vs 62 5 min 3 1 Hemodynamic outcomes The hemodynamic results are shown in Table 2 Only 25 patients in the control group and 22 patients in the HBO2 group had PA catheters inserted This was due to the insufficient numbers of monitoring equipment required for measuring hemodynamic readings This insufficiency occurred because the hemodynamic monitor

Page 63

Table 2 Hemodynamic measurements SV Postinduction 5 min post CPB 2 h post CPB 4 h post CPB 8 h post CPB 12 h post CPB 24 h post CPB Mean value S D Geometric mean estimate and 95 confidence interval p value a Mean value Geometric mean estimate and 95 confidence interval P value a Mean value Geometric mean estimate and 95 confidence interval P value a Mean value Geometric mean estimate and 95 confidence interval P value a Mean value Geometric mean estimate and 95 confidence interval P value a Mean value Geometric mean estimate and 95 confidence interval P value a Mean value Geometric mean estimate and 95 confidence interval P value a HBO2 group n 22 b Control group n 25 b PVR HBO2 group n 22 b Control group n 25 b PVRI HBO2 group n 22 b Control group n 25 b LVSW HBO2 group n 22 b Control group n 25 b LVSWI HBO2 group n 22 b Control group n 25 b HBO2 group n 22 b 61 8 16 4 64 5 15 2 Not significant 4 38 1 0 4 60 1 0 Not significant 158 74 2 115 77 6 1 55 1 05 2 29 P 03 292 120 228 154 1 49 1 01 2 19 P 05 58 3 19 3 60 1 18 1 Not significant 30 6 9 4 30 4 8 1 Not significant 59 9 12 8 66 1 13 8 1 13 1 03 1 25 P 01 4 85 1 2 5 22 0 9 Not significant 147 164 105 55 8 Not significant 214 85 1 208 113 Not significant 50 1 11 2 56 0 11 9 1 28 1 05 1 31 P 005 25 8 5 2 28 3 5 1 1 122 1 019 1 235 57 2 15 8 65 0 9 9 1 13 1 03 1 25 P 01 4 76 1 5 5 54 1 5 Not significant 140 68 4 150 93 0 Not significant 263 128 297 198 Not significant 59 4 20 2 76 1 20 0 1 28 1 05 1 31 P 005 31 1 10 0 38 7 11 3 1 122 1 019 1 235 58 1 13 4 60 0 12 5 1 13 1 03 1 25 P 01 5 41 1 5 5 74 1 4 Not significant 157 121 152 89 5 Not significant 306 254 298 172 Not significant 54 4 14 4 62 0 16 9 1 28 1 05 1 31 P 005 29 4 6 7 31 2 8 5 1 122 1 019 1 235 58 2 15 5 71 5 22 1 13 1 03 1 25 P 01 5 20 1 6 5 98 1 7 Not significant 130 73 5 115 62 6 Not significant 274 131 226 121 Not significant 57 7 16 3 69 7 23 4 1 28 1 05 1 31 P 005 29 8 6 9 35 0 11 3 1 122 1 019 1 235 67 8 15 8 68 0 11 9 1 13 1 03 1 25 P 01 5 48 1 1 5 75 1 0 Not significant 121 55 6 123 64 3 Not significant 230 99 9 245 128 Not significant 65 7 14 5 67 7 15 4 1 28 1 05 1 31 P 005 33 8 6 5 34 2 7 8 1 122 1 019 1 235 63 1 13 9 74 6 19 7 1 13 1 03 1 25 P 01 5 16 1 0 5 89 1 4 Not significant 150 85 8 106 49 4 Not significant 270 117 210 98 9 Not significant 67 2 14 6 79 6 26 5 1 28 1 05 1 31 P 005 35 1 8 0 40 5 15 0 1 122 1 019 1 235 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 Control group n 25 b CO a Ninety five percent confidence intervals are only given where the result is statistically significant the mean estimates and confidence intervals provided are obtained following translation of logged results back into estimates of the geometric mean of the ratio of the HBO group to control b This is an ITT analysis 13

Page 64

14 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 Table 3 Comparison of post CABG ICU stay Length of ICU stay h Control group n 40 Total Mean Range Geometric mean estimate and 95 confidence interval P value 1051 26 21 76 1 18 and 0 02 7 96 P 05 HBO2 group n 41 b 850 21 6 28 a a Geometric mean estimates and confidence intervals provided are obtained following translation of logged results back into estimates of the geometric mean of the ratio of the HBO group to control b This is an ITT analysis ing equipment was required for the management of more critical ICU patients From the hemodynamic measurements obtained we found that prior to CPB the control group had a 55 higher PVR P 03 estimate and 95 confidence interval 1 550 and 1 05 2 29 and a 49 higher PVRI P 05 estimate and 95 confidence interval 1 492 and 1 017 2 188 compared to the HBO2 group At all time points post CPB the HBO2 group had SV that was 13 higher P 01 estimate and 95 confidence interval 1 134 and 1 03 1 25 compared to the control group Furthermore at all time points post CPB the LVSW and the LVSWI in the HBO2 group was 28 P 005 estimate and 95 confidence interval 1 275 and 1 05 1 31 and 12 P 02 estimate and 95 confidence interval 1 122 and 1 019 1 235 higher than in the control group The HBO2 group had an 11 improvement in CO post CPB compared to the control group but this was not statistically significant P 06 estimate and 95 confidence interval 1 11 and 0 996 1 24 The other measured hemodynamic parameters revealed no clinically or statistically significant findings 3 2 Clinical outcomes Our results show that patients in the HBO2 group spent 24 min longer on mechanical ventilation P 2 and had 36 min longer endotracheal intubation time P 2 However patients in the HBO2 group had an 18 reduction in length of post CABG ICU stay P 05 estimate and 95 confidence interval for the difference 1 18 and 0 02 7 96 which equated to a geometric mean of 4 less in ICU length of stay post CABG Table 3 Apart from gastrointestinal complications which had similar incidences in both groups post CABG Table 4 the HBO2 group had a 10 4 reduction in low cardiac output syndrome P 4 an 8 reduction in inotrope usage P 1 an 11 reduction in atrial fibrillation P 6 a 12 7 reduction in pulmonary complications P 8 and a 7 6 reduction in infections P 4 Furthermore the HBO2 group had no incidences of renal and neurological complications of which there was an incidence of 5 and 2 5 respectively in the control group The results also showed that the HBO2 group of patients had a 57 reduction in intraoperative blood loss P 02 11 6 reduction in postoperative blood loss P 09 and a 34 reduction in postoperative blood transfusion P 4 Table 5 3 3 Serum troponin T results At approximately 1 h post HBO2 preconditioning the HBO2 group had no clinically significant change in serum troponin T levels and these results at this time point were reported as b0 02 ng ml by the laboratory Intra and postoperatively there were no statistically significant changes in serum troponin T in either group Clinically we observed that in both groups the concentration of serum troponin T appeared to rise from the onset of CPB to 24 h post CPB Fig 2 This rise however was greater in the Table 4 Post CABG complications Control group n 41 intention to treat Variable Low cardiac output Inotrope usage 1 Adrenaline 2 Dopamine 3 Noradrenaline 4 Adrenaline dopamine 5 Adrenaline noradrenaline 6 Adrenaline milrinone 7 Adrenaline noradrenaline milrinone Atrial fibrillation Pulmonary complications 1 Pneumothorax 2 Pleural effusion 3 Chest infection 3 Atelectasis requiring BiPAP CPAP 4 Chest infection pleural effusion 5 Other Renal complications creatinine N200 mmol l Neurological complications 1 Confusion blurred vision Gastrointestinal complications 1 Clostridia difficile diarrohea 2 Other Infections 1 Superficial sternal 2 Deep sternal 3 Leg Perioperative myocardial infarction Reoperation for bleeding Mortality HBO group n 40 intention to treat P value a 10 25 10 25 2 3 0 1 2 1 1 6 14 6 7 17 1 3 2 0 1 0 0 4 1 10 25 9 22 5 1 2 4 1 6 14 4 9 8 0 0 2 0 6 8 0 1 1 2 5 1 0 1 2 5 1 1 2 5 0 0 1 2 4 1 0 0 4 10 3 1 0 0 1 1 2 4 0 0 1 0 0 0 0 0 5 1 0 4 BiPAP Biphasic positive pressure ventilation CPAP continuous positive airway pressure a This is an ITT analysis

Page 65

J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 15 Table 5 Comparison of blood loss and blood transfusion Variable Intraoperative blood loss ml Mean Range Postoperative blood loss ml Mean Range Total blood transfusion ml Mean Range a Control group n 40 309 0 1528 727 255 1295 138 0 612 HBO2 group n 41 Reduction in HBO2 group P value a independent sample t test 95 Confidence intervals 309 133 309 100 57 02 318 to 32 727 643 727 100 11 6 1 31 to 200 138 91 138 100 34 4 63 to 159 133 0 961 643 325 1330 91 0 610 Intention to treat analysis control group than in the HBO2 group Furthermore 2 h post CPB in the HBO2 group the rise in serum troponin T appeared to plateau off while in the control group it appeared to continue to rise 3 4 Cost During the post hoc cost effectiveness analysis of this study the HBO2 treatment as a whole was estimated to be about US 402 75 per patient The cost for the ICU bed per day in our hospital was estimated as US 4000 00 Using these cost estimates we calculated Table 6 that patients treated with HBO2 preconditioning prior to CABG saved US 582 45 per patient in terms of ICU cost This means an estimated savings of US 116 49 per saved ICU hour As a study the 34 patients treated with HBO2 preconditioning saved an estimated US 19 803 67 in terms of ICU cost when compared to the control group 4 Discussion 4 1 The effects of HBO2 preconditioning and clinical outcomes and hemodynamic parameters Our study demonstrated that despite the slightly longer post CABG ventilation and intubation time the patients who Fig 2 Comparison of changes in serum troponin T in HBO2 and control group were preconditioned with HBO2 had a significantly P 05 shorter stay in ICU 5 h less Age CPB time and pre CABG COPD are known to affect ICU length of stay 28 29 The ages of patients and CPB times of both groups in this study were similar Table 1 Patients with COPD were excluded from this study as they are at risk of developing a pneumothorax and this risk is increased in an HBO2 chamber where there are changes in pressure during the pressurisation and depressurisation stages of the HBO2 treatment As such it is reasonable to deduce that HBO2 preconditioning was in part the cause for the shorter ICU stay observed in the HBO2 group Hemodynamically the results of this study showed that Table 2 prior to the onset of CPB the HBO2 group had a significantly lower PVR compared to the control group This reduction in PVR suggests that HBO2 preconditioning is capable of improving pulmonary vascular blood flow prior to the CABG and IRI Post CPB the HBO2 group had significantly increased SV and LVSW CO post CPB was improved in the HBO2 group but this was not a statistically significant finding though clinically important These results appear to suggest that HBO2 preconditioning prior to CABG has the capacity to enhance myocardial mechanical performance post CABG and IRI An indirect measure of support for our findings comes from the study by Dekleva et al 30 They conducted a randomized control study to assess the benefits of HBO2 after thrombolysis on the left ventricular function and remodelling in patients who had suffered from an AMI They observed that there was a significant decrease in end systolic volume index from the first day to the third week in HBO2 patients compared with the control patients This was accompanied with no changes in end diastolic volume index in the HBO2 group with increased values in the control group The ejection fraction was also significantly improved in the HBO2 group and decreased in the control group of patients 3 weeks after AMI Their study concluded that adjunctive HBO2 after thrombolysis in AMI has a favorable effect on left ventricular function and the remodelling process Furthermore it showed that in the

Page 66

16 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 Table 6 Summary of Cost Item Cost US dollars HBO2 treatment HBO2 treatment for 34 patients ICU bed per day ICU bed per hour ICU stay for 35 control patients A ICU stay for 34 HBO2 patients HBO2 treatment ICU stay for 34 patients B Total savings for HBO2 patients A B C savings made by 34 HBO2 patients who spent a total of 1051 850 201 h less in ICU see Table 3 Savings per HBO2 patient in ICU Savings per ICU hour saved in each HBO2 patient 402 75 13 693 50 4000 00 166 67 166 67 1051 175 166 67 166 67 850 141 669 50 13 693 50 141 669 50 155 363 00 175 166 67 155 363 00 19 803 67 582 45 116 49 absence of HBO2 to adjunct thrombolysis the control group went on to develop systolic and diastolic disimprovement post AMI Further support comes from the HOT MI study 21 which showed an improvement in post MI ejection fraction In another study Swift et al 31 evaluated the potential for HBO2 to produce improvement in myocardial function in the hibernating myocardium In that study they found that patients who were also treated with HBO2 following an AMI had improved myocardial contraction as observed by echocardiography and demonstrated reversible ischemia as determined by SPECT imaging compared to those patients who were not treated with HBO2 post AMI More recently Aparci et al 32 also found that in diabetic patients who were being treated for nonhealing lower extremity ulcers after 10 HBO2 treatment sessions these patients had an improved diastolic function These clinical studies suggest that HBO2 has the clinical potential to stimulate and improve myocardial function Over the years other investigators have also observed the clinically beneficial effects of HBO2 treatment Where low cardiac output is concern Yacoub and Zeitlin 33 reported in 1965 that post cardiac surgery and therefore post IRI treatment of low cardiac output syndrome with HBO2 resulted in satisfactory clinical outcome In our study we found that preconditioning with HBO2 prior to IRI was also capable of reducing the incidence of low cardiac output syndrome Table 4 In 1973 Thurston et al 34 conducted a randomised control study to examine the effects of HBO2 on mortality following recent AMI This group observed that in the HBO2 group there was a reduction in mortality 3 weeks after an AMI and a reduction in significant dysrrhythmias complete heart block ventricular fibrillation and asystole In the clinical study conducted by us we also found that HBO2 preconditioning was beneficial by way of lowering the incidence of post CABG inotrope usage atrial fibrillation and general pulmonary renal and neurological complications Table 4 With respect to sternal wound infection there are a number of studies 35 38 that have shown that HBO2 is a useful adjunct to promote sternal wound healing following postoperative sternal wound breakdown The reduction in the incidence of wound infection observed in our study Table 4 appears to also suggest that HBO2 preconditioning prior to median sternotomy may have a prophylactic antimicrobial effect that is capable of reducing both superficial and deep sternal wound infections post CABG Perhaps this may be linked to the antimicrobial properties of oxygen and HBO2 39 Where cost was concerned we found that the significantly shorter length of ICU stay among patients preconditioned with HBO2 was associated with savings in hospital cost Table 6 With respect to blood loss our results Table 5 showed that HBO2 preconditioning prior to CABG and IRI appears to result in a reduction in intraoperative and postoperative blood loss and postoperative blood transfusion Presently there is only one case report that has documented the successful use of HBO2 to stop hematuria in a patient following ischemic haemorrhagic cystitis 40 In a recent animal study 41 HBO2 treatment following occlusion and reperfusion of middle cerebral artery was shown to be useful in reducing hemorrhagic transformation after this focal transient cerebral ischemia These results suggest that HBO2 prior to IRI our study and post IRI 40 41 may be a useful pharmacological therapy at least as an adjunct in efforts to limit perioperative blood loss and conserve blood This may partly result from the ability of HBO2 to reduce vascular permeability 41 42 4 2 The effects of HBO2 preconditioning and serum troponin T In our study we observed that 1 h following HBO2 treatment serum from patients in the HBO2 group did not show any clinically valuable change in serum troponin T levels This suggests that 1 h following the oxidative stress of HBO2 this modality of treatment does not cause any clinically detectable myocardial injury and is a safe modality of treatment While there have been no other experimental or clinical studies involving HBO2 and troponin T the HOT MI study 21 found that in the HBO2 group there was a 35 reduction in mean CK at 12 and 24 h post MI and concluded that adjunctive HBO2 was a feasible and safe treatment for AMI Clinical studies have yet to find any correlation between oxidative stress myocardial injury and troponin T release 43 45 In our study we observed that following CPB the HBO2 group showed a smaller increase in serum troponin T Moreover in the HBO2 group the rise in serum troponin T stopped 2 h post CPB and the levels plateaued off while in the control group serum troponin T appeared to continue to rise This suggests that the oxidative stress of HBO2 preconditioning prior to the oxidative stress of IRI during CABG induces a myocardial protective mechanism that limits the degree of myocardial necrosis and the subsequent troponin T release This implies that precondi

Page 67

J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 tioning with HBO2 prior to on pump CPB CABG and IRI may have the ability to attenuate myocardial injury post CPB Essentially HBO2 preconditioning prior to ischemia and reperfusion as utilised in this study functions as a mode of ROS preconditioning Both HBO2 therapy 6 and ischemia and reperfusion 46 generate ROS It is possible that by preconditioning patients with HBO2 and exposing them to the nonlethal controlled dose of ROS that results from HBO2 a complex set of biological protective pathways are initiated As such when patients are subsequently exposed to a further burst of ROS as occurs during ischemia and reperfusion which normally lead to cellular injury and clinical dysfunction 47 there is already a protective mechanism that has been initiated to enable better tolerance to this insult Various studies have demonstrated that low doses of ROS 48 50 and ROS preconditioning 51 53 lead to myocardial protection Additionally Yaguchi et al 54 demonstrated that ROS preconditioning leads to better myocardial protection than just ischemic preconditioning alone 5 Conclusion This single centre randomised control study in patients with CAD was designed to determine whether preconditioning these patients with one session of HBO2 prior to firsttime elective on pump CPB CABG was capable of further improving myocardial function during ischemia and reperfusion post CABG In this clinical study the primary end point was met It demonstrated that preconditioning CAD patients with HBO2 prior to on pump CPB CABG was capable of improving LVSW P 005 24 h post CPB However this study only met with some of its secondary hemodynamic end points In this study prior to the onset of CPB the HBO2 group had a lower PVR P 03 and PVRI P 05 Furthermore this study also showed that at all time points post CPB only SV P 01 and LVSWI P 02 increased in the HBO2 group Additionally it was observed that there was an 18 reduction in ICU stay following HBO2 preconditioning and CABG P 05 and a 57 reduction P 02 in intraoperative blood loss While none of the other clinical secondary end points reached significance there were some interesting improvements in clinical outcomes in the HBO2 group of patients Postoperatively the HBO2 group had a reduction in blood loss 11 6 blood transfusion 12 7 low cardiac output syndrome 10 4 inotrope use 8 atrial fibrillation 11 pulmonary complications 12 7 and wound infections 7 6 This small clinical study provides some evidence that preconditioning CAD patients with HBO2 prior to first time elective on pump CPB CABG was capable of improving myocardial function post CABG while also improving pulmonary vascular flow prior to CABG It also attenuated the degree of myocardial injury and troponin T release post CABG Additionally following CABG it reduced postoperative complications and the length of ICU stay and was 17 cost effective While the results are encouraging the strength of the evidence from this study is still weak This is a consequence of the major limitation of this study which was that the total number of patients was small Furthermore the cohort of patients recruited to this study was a relatively lowrisk group and as such the actual impact of HBO2 preconditioning may not have been easily appreciated As the centre where this study was carried out did not regularly perform CABG without the use of CPB i e off pump CABG no comparison was made with a group of CAD patients who had CABG without the use of CPB Additionally no comparison was made with a group of patients who were treated with a controlled ischemia and reperfusion protocol prior to the multiple variable periods of ischemia and reperfusion that occurred during this clinical study involving CABG and IRI The trend for HBO2 preconditioning to demonstrate beneficial clinical biological and economic effects in lowrisk CABG patients as observed in this study also provides encouragement for its use in more high risk patients who are about to undergo on pump CPB CABG Surgeons and anaesthetists may wish to consider this modality of treatment to further optimise the clinical condition of more high risk patients prior to embarking on complex cardiac surgical procedures involving prolonged periods of ischemia and reperfusion that traditionally are associated with poor postoperative clinical outcomes Despite promising results the future of HBO2 preconditioning medicine remains unclear as this modality of treatment is not found in the vicinity of every acute hospital and where available it is not of appropriate design and lacks the facilities to accommodate an unwell post cardiac surgical ICU patient For this modality of treatment to become a recognised and more frequently used modality of treatment more translational studies are required to facilitate the transition from bench research to the bedside clinical therapy More HBO2 units are required in major acute hospitals with a design that is capable of caring for critically ill ICU patients such as in various centres in the USA Sweden Norway and Australia Furthermore more well conducted multicentre randomised control studies are required not only to validate laboratory findings but to also to address the clinical issues in the real world and provide an evidence based platform for its use in day to day clinical care Acknowledgments We would like to acknowledge the contribution of our professional statistician Dr E Gardiner References 1 American Heritage Dictionary Boston Houghton Mifflin Co 1994 2 Morykwas MJ Argenta LC Nonsurgical modalities to enhance healing and care of soft tissue wounds J South Orthop Assoc 1997 6 279 88

Page 68

18 J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 3 Kindwall EP Whelan HT Hyperbaric Medicine Practice Flagstaff AZ Best Publishing Company 2002 4 Benedetti S Lamorgese A Piersantelli M Pagliarani S Benvenuti F Canestrari F Oxidative stress and antioxidant status in patients undergoing prolonged exposure to hyperbaric oxygen Clin Biochem 2004 37 312 7 5 Gregorevic P Lynch GS Williams DA Hyperbaric oxygen modulates antioxidant enzyme activity in rat skeletal muscles Eur J Appl Physiol 2001 86 24 7 6 Conconi MT Baiguera S Guidolin D Furlan C Menti AM Vigolo S Belloni AS Parnigotto PP Nussdorfer GG Effects of hyperbaric oxygen on proliferative and apoptotic activities and reactive oxygen species generation in mouse fibroblast 3T3 J2 cell line J Investig Med 2003 51 227 32 7 Yogaratnam JZ Laden G Madden LA Seymour AM Guvendik L Cowen M Greenman J Cale A Griffin S Hyperbaric oxygen a new drug in myocardial revascularization and protection Cardiovasc Revasc Med 2006 7 146 54 8 Kloner RA Przyklenk K Whittaker P Deleterious effects of oxygen radicals in ischemia reperfusion Resolved and unresolved issues Circulation 1989 80 1115 27 9 Kukreja RC Hess ML The oxygen free radical system from equations through membrane protein interactions to cardiovascular injury and protection Cardiovasc Res 1992 26 641 55 10 Sterling DL Thornton JD Swafford A Gottlieb SF Bishop SP Stanley AW Downey JM Hyperbaric oxygen limits infarct size in ischemic rabbit myocardium in vivo Circulation 1993 88 1931 6 11 Kim CH Choi H Chun YS Kim GT Park JW Kim MS Hyperbaric oxygenation pretreatment induces catalase and reduces infarct size in ischemic rat myocardium Pflugers Arch 2001 442 519 25 12 Han C Lin L Zhang W Zhang L Lv S Sun Q Tao H Zhang JH Sun X Hyperbaric oxygen preconditioning alleviates myocardial ischemic injury in rats Exp Biol Med Maywood 2008 233 1448 53 13 Yogaratnam JZ Laden G Guvendik L Cowen M Cale A Griffin S Can hyperbaric oxygen be used as adjunctive heart failure therapy through the induction of endogenous heat shock proteins Adv Ther 2007 24 106 18 14 Jugdutt BI Nitric oxide and cardioprotection during ischemiareperfusion Heart Fail Rev 2002 7 391 405 15 Li W Jia G Guo W Wang H Nitric oxide opens second window of protection in ischemic preconditioning via induction of heat shock protein 72 Chin Med J Engl 2003 116 258 62 16 Lopez Ongil S Hernandez Perera O Navarro Antolin J Perez de Lema G Rodriguez Puyol M Lamas S Rodriguez Puyol D Role of reactive oxygen species in the signalling cascade of cyclosporine Amediated up regulation of eNOS in vascular endothelial cells Br J Pharmacol 1998 124 447 54 17 Arnaud C Joyeux M Garrel C Godin Ribuot D Demenge P Ribuot C Free radical production triggered by hyperthermia contributes to heat stress induced cardioprotection in isolated rat hearts Br J Pharmacol 2002 135 1776 82 18 Sharifi M Fares W Abdel Karim I Koch JM Sopko J Adler D Usefulness of hyperbaric oxygen therapy to inhibit restenosis after percutaneous coronary intervention for acute myocardial infarction or unstable angina pectoris Am J Cardiol 2004 93 1533 5 19 Kudchodkar BJ Wilson J Lacko A Dory L Hyperbaric oxygen reduces the progression and accelerates the regression of atherosclerosis in rabbits Arterioscler Thromb Vasc Biol 2000 20 1637 43 20 Kudchodkar BJ Pierce A Dory L Chronic hyperbaric oxygen treatment elicits an anti oxidant response and attenuates atherosclerosis in apoE knockout mice Atherosclerosis 2006 21 Shandling AH Ellestad MH Hart GB Crump R Marlow D Van Natta B Messenger JC Strauss M Stavitsky Y Hyperbaric oxygen and thrombolysis in myocardial infarction the HOT MI pilot study Am Heart J 1997 134 544 50 22 Wang X Wei M Kuukasjarvi P Laurikka J Jarvinen O Rinne T Honkonen EL Tarkka M Novel pharmacological preconditioning 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 with diazoxide attenuates myocardial stunning in coronary artery bypass grafting Eur J Cardiothorac Surg 2003 24 967 73 Alex J Laden G Cale AR Bennett S Flowers K Madden L Gardiner E McCollum PT Griffin SC Pretreatment with hyperbaric oxygen and its effect on neuropsychometric dysfunction and systemic inflammatory response after cardiopulmonary bypass a prospective randomized double blind trial J Thorac Cardiovasc Surg 2005 130 1623 30 Piantadosi S Clinical Trials Clinical Trials A Methodologic Perspective John Wiley Sons 1997 p 394 6 Altman D Intention to Treat Practical Statistics for Medical Research Chapman Hall 1990 Hollis S Campbell F What is meant by intention to treat analysis Survey of published randomised controlled trials BMJ 1999 319 670 4 Molenberghs G Kenward MG Missing Data in Clinical Studies Chichester John Wiley Sons Inc 2007 p 504 Rosenfeld R Smith JM Woods SE Engel AM Predictors and outcomes of extended intensive care unit length of stay in patients undergoing coronary artery bypass graft surgery J Card Surg 2006 21 146 50 Nakasuji M Matsushita M Asada A Risk factors for prolonged ICU stay in patients following coronary artery bypass grafting with a long duration of cardiopulmonary bypass J Anesth 2005 19 118 23 Dekleva M Neskovic A Vlahovic A Putnikovic B Beleslin B Ostojic M Adjunctive effect of hyperbaric oxygen treatment after thrombolysis on left ventricular function in patients with acute myocardial infarction Am Heart J 2004 148 E14 Swift PC Turner JH Oxer HF O Shea JP Lane GK Woollard KV Myocardial hibernation identified by hyperbaric oxygen treatment and echocardiography in postinfarction patients comparison with exercise thallium scintigraphy Am Heart J 1992 124 1151 8 Aparci M Kardesoglu E Suleymanoglu S Uzun G Onem Y Uz O Kucukardali Y Ozkan S Hyperbaric oxygen therapy improves myocardial diastolic function in diabetic patients Tohoku J Exp Med 2008 214 281 9 Yacoub MH Zeitlin GL Hyperbaric oxygen in the treatment of the postoperative low cardiac output syndrome Lancet 1965 191 581 3 Thurston JG Greenwood TW Bending MR Connor H Curwen MP A controlled investigation into the effects of hyperbaric oxygen on mortality following acute myocardial infarction Q J Med 1973 42 751 70 De Feo M Gregorio R Della Corte A Marra C Amarelli C Renzulli A Utili R Cotrufo M Deep sternal wound infection the role of early debridement surgery Eur J Cardiothorac Surg 2001 19 811 6 Barili F Polvani G Topkara K Dainese L Cheema FH Roberto M Naliato M Parolari A Alamanni F Biglioli P Role of hyperbaric oxygen therapy in the treatment of postoperative organ space sternal surgical site infections World J Surg 2007 Lappa A Malpieri MR Cicco M Bucci A Malpieri M Araimo F Alampi D An alternative inexpensive treatment for deep sternal wound infections after sternotomy Interact Cardiovasc Thorac Surg 2003 2 629 32 Petzold T Feindt PR Carl UM Gams E Hyperbaric oxygen therapy in deep sternal wound infection after heart transplantation Chest 1999 115 1455 8 Park MK Myers RA Marzella L Oxygen tensions and infections modulation of microbial growth activity of antimicrobial agents and immunologic responses Clin Infect Dis 1992 14 720 40 Lopez AE Rodriguez S Flores I Management of ischemic hemorrhagic cystitis with hyperbaric oxygen therapy Undersea Hyperb Med 2001 28 35 6 Qin Z Karabiyikoglu M Hua Y Silbergleit R He Y Keep RF Xi G Hyperbaric oxygen induced attenuation of hemorrhagic transformation after experimental focal transient cerebral ischemia Stroke 2007 38 1362 7 Veltkamp R Siebing DA Sun L Heiland S Bieber K Marti HH Nagel S Schwab S Schwaninger M Hyperbaric oxygen reduces

Page 69

J Z Yogaratnam et al Cardiovascular Revascularization Medicine 11 2010 8 19 43 44 45 46 47 48 blood brain barrier damage and edema after transient focal cerebral ischemia Stroke 2005 36 1679 83 Berg K Haaverstad R Astudillo R Bjorngaard M Skarra S Wiseth R Basu S Jynge P Oxidative stress during coronary artery bypass operations importance of surgical trauma and drug treatment Scand Cardiovasc J 2006 40 291 7 Berg K Jynge P Bjerve K Skarra S Basu S Wiseth R Oxidative stress and inflammatory response during and following coronary interventions for acute myocardial infarction Free Radic Res 2005 39 629 36 Berg K Wiseth R Bjerve K Brurok H Gunnes S Skarra S Jynge P Basu S Oxidative stress and myocardial damage during elective percutaneous coronary interventions and coronary angiography A comparison of blood borne isoprostane and troponin release Free Radic Res 2004 38 517 25 Robin E Guzy RD Loor G Iwase H Waypa GB Marks JD Hoek TL Schumacker PT Oxidant stress during simulated ischemia primes cardiomyocytes for cell death during reperfusion J Biol Chem 2007 282 19133 43 Moens AL Claeys MJ Timmermans JP Vrints CJ Myocardial ischemia reperfusion injury a clinical view on a complex pathophysiological process Int J Cardiol 2005 100 179 90 Hegstad AC Antonsen OH Ytrehus K Low concentrations of hydrogen peroxide improve post ischaemic metabolic and functional 49 50 51 52 53 54 19 recovery in isolated perfused rat hearts J Mol Cell Cardiol 1997 29 2779 87 Valen G Skjelbakken T Vaage J The role of nitric oxide in the cardiac effects of hydrogen peroxide Mol Cell Biochem 1996 159 7 14 Ytrehus K Walsh RS Richards SC Downey JM Hydrogen peroxide as a protective agent during reperfusion A study in the isolated perfused rabbit heart subjected to regional ischemia Cardiovasc Res 1995 30 1033 7 Valen G Starkopf J Takeshima S Kullisaar T Vihalemm T Kengsepp AT Lowbeer C Vaage J Zilmer M Preconditioning with hydrogen peroxide H2O2 or ischemia in H2O2 induced cardiac dysfunction Free Radic Res 1998 29 235 45 Takeshima S Vaage J Valen G Can reactive oxygen species precondition the isolated rat heart against arrhythmias and stunning Acta Physiol Scand 1997 161 263 70 Sun JZ Tang XL Park SW Qiu Y Turrens JF Bolli R Evidence for an essential role of reactive oxygen species in the genesis of late preconditioning against myocardial stunning in conscious pigs J Clin Invest 1996 97 562 76 Yaguchi Y Satoh H Wakahara N Katoh H Uehara A Terada H Fujise Y Hayashi H Protective effects of hydrogen peroxide against ischemia reperfusion injury in perfused rat hearts Circ J 2003 67 253 8

Page 70

J Appl Physiol 115 819 828 2013 First published July 3 2013 doi 10 1152 japplphysiol 00625 2013 Baroreflex mediated cardiovascular responses to hyperbaric oxygen Ivan T Demchenko 1 2 4 Sergei Y Zhilyaev 4 Alexander N Moskvin 4 Alexander I Krivchenko 4 Claude A Piantadosi 1 2 3 and Barry W Allen1 2 1 Center for Hyperbaric Medicine and Environmental Physiology Duke University Medical Center Durham North Carolina Department of Anesthesiology Duke University Medical Center Durham North Carolina 3Department of Medicine Duke University Medical Center Durham North Carolina and 4Institute of Evolutionary Physiology and Biochemistry Russian Academy of Sciences St Petersburg Russia 2 Submitted 23 May 2013 accepted in final form 27 June 2013 Demchenko IT Zhilyaev SY Moskvin AN Krivchenko AI Piantadosi CA Allen BW Baroreflex mediated cardiovascular responses to hyperbaric oxygen J Appl Physiol 115 819 828 2013 First published July 3 2013 doi 10 1152 japplphysiol 00625 2013 The cardiovascular system responds to hyperbaric hyperoxia HBO2 with vasoconstriction hypertension bradycardia and reduced cardiac output CO We tested the hypothesis that these responses are linked by a common mechanism activation of the arterial baroreflex Baroreflex function in HBO2 was assessed in anesthetized and conscious rats after deafferentation of aortic or carotid baroreceptors or both Cardiovascular and autonomic responses to HBO2 in these animals were compared with those in intact animals at 2 5 ATA for conscious rats and at 3 ATA for anesthetized rats During O2 compression hypertension was greater after aortic or carotid baroreceptor deafferentation and was significantly more severe if these procedures were combined Similarly the hyperoxic bradycardia observed in intact animals was diminished after aortic or carotid baroreceptor deafferentation and replaced by a slight tachycardia after complete baroreceptor deafferentation We found that hypertension bradycardia and reduced CO the initial cardiovascular responses to moderate levels of HBO2 are coordinated through a baroreflex mediated mechanism initiated by HBO2 induced vasoconstriction Furthermore we have shown that baroreceptor activation in HBO2 inhibits sympathetic outflow and can partially reverse an O2 dependent increase in arterial pressure hyperbaric oxygen baroreflex hypertension bradycardia autonomic nervous system THE MAMMALIAN CARDIOVASCULAR system responds acutely to hyperoxia with vasoconstriction hypertension bradycardia and decreased cardiac output CO Although these effects have been investigated for many years and several hypotheses have been proposed to explain them individually no physiological process that links them through a common mechanism is known Vasoconstriction thought to be the primary response to hyperoxia has been observed in animals healthy volunteers and patients 26 33 46 particularly in hyperbaric oxygen HBO2 It has been variously attributed to direct effects on vascular smooth muscle of O2 or reactive O2 species 21 48 to O2 mediated alterations in endothelial derived vasoactive agents such as nitric oxide NO 12 32 35 and endothelin 1 9 or to products of arachidonic acid metabolism 34 Neuronal mechanisms such as a de activation of arterial chemoreceptors 15 24 have also been suggested but not established The arterial hypertension reported in most animal and Address for reprint requests and other correspondence B W Allen Duke Univ Medical Center DUMC 3823 Bldg CR II Durham NC 27710 e mail barry w allen duke edu http www jappl org human studies involving HBO2 1 3 6 22 44 47 has been attributed to hyperoxic vasoconstriction but this remains hypothetical Bradycardia is also a consistent effect of hyperbaric hyperoxia and is abolished by muscarinic blockade or vagotomy 3 16 In addition power spectrum analysis of heart rate variability HRV indicates that HBO2 slows the heart by increasing parasympathetic activity 25 further implicating vagal efferents however no trigger has been identified for this parasympathetic restraint The reduction in CO observed in HBO2 has been ascribed to hyperoxic bradycardia but diminished cardiac contractility may also be a factor 27 30 36 If vasoconstriction is the primary response to hyperbaric hyperoxia leading to increases in vascular resistance and arterial pressure AP and if bradycardia and decreased CO are secondary effects then the acute cardiovascular responses observed in HBO2 could be explained by activation of the baroreflex which is normally the principal moment to moment regulator of blood pressure 19 This hypothesis predicts that elevations in AP due to hyperoxic vasoconstriction activate mechanoreceptors in the aortic arch and carotid sinuses the major baroreceptors The resulting afferent discharges would evoke central responses that suppress efferent sympathetic activity and augment parasympathetic outflow diminishing cardiac rate contractility and output as well as peripheral vascular resistance Although several investigators have suggested that the baroreflex contributes to bradycardia in normobaric hyperoxia 10 15 studies do not support this idea conclusively because the latency of the negative chronotropic response is longer than expected for known neural reflexes and HR sometimes fails to return to baseline when normoxia is restored Therefore hyperoxic bradycardia did not appear to be explained solely by the baroreflex 18 24 Assessments of baroreflex sensitivity BRS in normobaric hyperoxia have also shown conflicting results with increases 5 38 45 and decreases 18 being reported In hyperbaric hyperoxia however cardiovascular responses to O2 are more clearly defined but baroreflex function has not been investigated in these conditions Therefore we designed this study to test whether the several cardiovascular responses to HBO2 are linked by a common physiological mechanism and to determine whether the arterial baroreflex is involved in the resulting alterations in cardiac function and AP METHODS AND EXPERIMENTAL DESIGN Experiments with Anesthetized Rats Surgical preparation Male Sprague Dawley rats Charles River Laboratories Wilmington MA approximately 300 400 g were 8750 7587 13 Copyright 2013 the American Physiological Society Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022 819

Page 71

820 Baroreflex Mediated Cardiovascular Responses to HBO2 Demchenko IT et al Table 1 Experimental design Cardiovascular Measurements Group Anesthetized 1 2 3 4 5 6 7 8 9 Conscious 1 2 3 4 n 100 O2 ATA Denervation Antagonist AP ECG 5 5 5 5 5 7 7 12 12 3 3 3 3 3 3 3 3 3 VE PB PR TB LN AD CD Complete Intact 12 8 8 12 2 5 2 5 2 5 2 5 Intact AD CD Complete RSNA tCBF CO BRS O2 oxygen AP arterial pressure RSNA renal sympathetic nerve activity tCBF total cerebral blood flow CO cardiac output BRS baroreflex sensitivity VE vehicle controls 0 9 sodium chloride PB phenoxybenzamine PR propranolol TB tiotropium bromide LN NG nitro L arginine methyl ester AD aortic baroreceptor denervation CD carotid baroreceptor denervation complete aortic carotid baroreceptor denervation intact baroreceptors intact with sham procedure RSNA was averaged over 10 s and expressed as percent change from baselines in animals breathing room air AP and HR were recorded in real time with WinDaq software using DI 200 data acquisition hardware DATAQ Instruments Akron OH or with LabScribe 2 software using iWorx IX 228 S hardware iWorx Systems Dover NH The SD for mean AP MAP and HR was defined as AP variability APV and HRV and expressed as percentages Systemic vascular resistance SVR and cerebrovascular resistance CVR were computed as MAP CO and MAP tCBF BRS assessment BRS the effect of changes in AP on HR was assessed pharmacologically 40 or with the sequence method 42 Pharmacologically BRS was quantified as the slope of the linear regression for the change in HR or R wave to R wave RR interval for a given change in systolic AP SAP after bolus injections 0 1 ml iv of phenylephrine PHE or sodium nitroprusside SNP and expressed as bpm mmHg or ms mmHg To assess the effectiveness of baroreceptor denervation doses of PHE 2 6 g kg or SNP 5 15 g kg were adjusted to raise or lower SAP between 20 and 40 mmHg For BRS assessment during O2 isopression the period of constant pressure between the end of compression and the start of decompression PHE 4 g kg was injected over 3 s at 10 min intervals In the sequence method BRS was assessed during the O2 compression to 3 ATA when AP increases spontaneously A series of consecutive AP pulses was identified in which SAP and the concurrent RR interval averaged for 5 s both increased A linear regression slope ms mmHg was determined for each 5 s sequence used according to a protocol approved by the Duke University Institutional Animal Use and Care Committee using methods reported previously 14 Baroreceptor denervation Baroreceptors were denervated as described 8 37 For selective aortic baroreceptor denervation AD the aortic depressor nerves and their communicating branches were severed bilaterally proximal to the vagus For selective carotid baroreceptor denervation CD each common carotid artery was exposed 2 3 mm above and below its bifurcation stripped of neuronal tissue and painted with 10 phenol in ethanol to inactivate any remaining fibers For animals with complete barodenervation AD and CD were combined In sham operated rats intact the relevant nerve trunks were exposed but undamaged The trachea was intubated and mechanical ventilation instituted with room air Pancuronium bromide 0 5 mg kg iv was administered to prevent voluntary respiratory movements and permit control of arterial carbon dioxide partial pressure PCO2 by adjusting tidal volume Arterial blood gases and pH were measured as reported 14 Rectal temperature was monitored with a thermistor and maintained at 37 0 5 C using a heating pad Measurements and calculations AP was measured continuously using a pressure transducer Viggo Spectramed Oxnard CA Total cerebral blood flow tCBF was calculated from hydrogen H2 washout curves detected by the supradural electrode 13 CO was calculated from transpulmonary thermodilution curves obtained after injection of 75 l of room temperature glucose solution 2 5 and was normalized for body weight ml min 1 100 g body wt 1 Renal sympathetic nerve activity Table 2 Baseline hemodynamic parameters in anesthetized rats MAP mmHg SAP mmHg MAPV HR beat min HRV CBF ml 100 g 1 min 1 CO ml 100 g 1 min 1 SVR MAP CO CVR MAP CBF Intact AD CD Complete 96 5 121 7 9 4 1 2 362 21 8 9 0 8 82 6 3 38 1 9 2 53 0 12 1 17 0 08 103 7 128 9 12 9 1 3 373 18 5 8 0 6 78 6 1 40 3 1 2 53 0 14 1 28 0 09 105 7 131 8 13 3 1 8 375 17 5 9 0 7 80 6 4 39 3 1 2 69 0 17 1 31 0 1 119 9 142 12 15 1 2 7 409 19 5 6 0 5 79 5 4 43 3 6 2 77 0 21 1 51 0 14 MAP mean AP SAP systolic AP MAPV MAP variability HR heart rate HRV HR variability SVR systemic vascular resistance CVR cerebrovascular resistance Values are means SE P 0 05 vs intact control J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 72

Baroreflex Mediated Cardiovascular Responses to HBO2 A 60 BRS Intact AD CD HR beats min 40 20 1 15 0 52 0 35 20 40 60 40 20 0 20 40 60 A 150 60 BRS Intact 1 15 Complete 0 07 HR beats min 40 20 0 MAP control SAP mmHg B 821 Demchenko IT et al Russian Academy Sciences St Petersburg Russia according to a protocol approved by the Ethical Review Board of the Institute Chronic catheterization and baroreceptor denervation Male Wistar rats Rappolovo animal breeding facility Russia weighing approximately 260 330 g were anesthetized with pentobarbital 50 mg kg ip and a polyethylene catheter PE 10 was advanced through the right carotid artery into the aortic arch for recording AP A left jugular vein catheter and ECG electrodes were installed Baroreceptors were denervated partially or totally or subjected to a sham procedure as described above The incision was closed with wound clips All catheters were secured with ligatures filled with a solution containing sodium chloride NaCl 0 9 glucose 2 5 and heparin 300 IU ml and together with ECG electrode leads tunneled subcutaneously to the back of the neck Animals were given penicillin 30 000 IU kg and allowed to recover from surgery for 5 7 days Catheters were refilled daily with fresh solution 0 60 100 50 20 40 0 0 5 55 60 3 ATA O2 exposure min 60 40 20 0 20 40 60 SAP mmHg Fig 1 Baroreflex sensitivity BRS in anesthetized rats breathing room air after baroreceptor denervation A BRS assessed by bolus injection of nitroprusside left data clusters or phenylephrine PHE right data clusters was diminished in selectively baroreceptor denervated aortic baroreceptor denervation AD open squares and carotid baroreceptor denervation CD closed triangles rats compared with intact animals closed circles B BRS was impaired severely in animals with fully deafferented baroreceptor animals open circles the slope of regression line approaches 0 HR change in heart rate SAP change in systolic arterial pressure intact baroreceptors intact with sham procedure complete AD CD HBO2 exposures Baseline physiological parameters were recorded over a 60 min stabilization period as each rat was ventilated with room air The ventilator was then supplied with 100 O2 as the hyperbaric chamber Duke Center for Hyperbaric Medicine and Environmental Physiology Durham NC was pressurized with air to 3 ATA at 1 ATA min Exposures were limited to 60 min Chamber temperature and relative humidity were maintained at 23 0 5 C and 60 2 Decompression was accomplished at 0 6 ATA min as the rat continued to breathe 100 O2 Animals were euthanized with Nembutal 250 mg kg iv while anesthetized Experiments with Conscious Rats To control for anesthesia experiments were performed with conscious animals at the Institute of Evolutionary Physiology and Biochemistry B 150 HR control 60 100 Saline PR PhB TB L NAME 50 0 0 5 55 60 3 ATA O2 exposure min Fig 2 Cardiovascular responses in anesthetized rats in hyperbaric oxygen HBO2 at 3 ATA after adrenergic or cholinergic receptor blockade A and B mean AP MAP and HR responses averaged over 5 min were assessed at the beginning and end of the isopression phase 0 5 min and 55 60 min in rats pretreated with vehicle saline phenoxybenzamine PhB propranolol PR tiotropium bromide TB or NG nitro L arginine methyl ester L NAME Values are means SE P 0 05 vs pre exposure levels J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 73

822 Baroreflex Mediated Cardiovascular Responses to HBO2 Hemodynamic measurements and baroreflex assessment Methods for acquiring and analyzing data were similar to those described for anesthetized animals WinDaq data acquisition software WinDaq software and DI 200 data acquisition hardware DATAQ Instruments To confirm baroreceptor denervation BRS was assessed pharmacologically with PHE 4 g kg iv 5 7 days after surgery During compression BRS was determined with the sequence method In isopression spontaneous changes in AP mostly associated with voluntary movement were also used to assess BRS by the sequence method using four or more consecutive AP pulses in which SAP and RR intervals both increased A linear regression slope ms mmHg was determined for selected sequences as described 42 HBO2 exposures To produce responses comparable with those observed in anesthetized animals at 3 ATA awake rats were individually exposed to 100 O2 at 2 5 ATA 60 min while suspended in a hammock to which they had been habituated and AP and ECG were monitored continuously The chamber was compressed with O2 at 1 ATA min and decompressed at 0 6 ATA min Chamber temperature and relative humidity were maintained at 23 0 5 C and 60 2 Experimental Design MAP change 30 denervated to determine their separate and combined contributions to the baroreflex response in HBO2 Animals in group 9 were subjected to a sham procedure and served as controls CO or BRS was assessed separately in intact rats and in those with complete baroreceptor deafferentation Conscious rats n 40 were exposed to HBO2 at 2 5 ATA for 60 min and included intact AD and CD rats and those with complete baroreceptor deafferentation Table 1 AP and ECG were monitored continuously and BRS was assessed Statistical Analysis Data were analyzed using StatView software SAS Institute Cary NC Absolute or percentage changes in hemodynamic parameters or BRS were compared with baselines in room air using repeated measures ANOVA When a significant F ratio was obtained Fisher s least significant difference test was used All values were expressed as means SE Comparisons among groups were made using two way ANOVA followed by a paired t test with Bonferroni correction for multiple comparisons Significance was accepted at P 0 05 Anesthetized Rats Baseline hemodynamic parameters after baroreceptor denervation Mean hemodynamic parameters in selectively denervated rats did not differ significantly from those in intact rats 2 h after surgery but mean APV MAPV was greater and HRV was less than in the intact group Table 2 In animals with complete baroreceptor deafferentation most hemodynamic parameters including MAPV and HRV differed significantly from values observed in intact rats Table 2 As B HR change 40 20 10 tCBF change 10 D CVR change 20 20 10 0 10 20 30 0 C Demchenko IT et al RESULTS Anesthetized rats n 63 in nine experimental groups were individually exposed to HBO2 at 3 ATA for 60 min Table 1 Groups 1 5 were pretreated 30 min before hyperbaric exposure with 0 9 NaCl vehicle controls the nonselective receptor antagonist phenoxybenzamine 0 5 mg kg ip the nonselective receptor antagonist propranolol 0 5 mg kg ip the muscarinic receptor antagonist tiotropium bromide 18 g kg ip or the nonselective inhibitor of NO synthesis NG nitro L arginine methyl ester L NAME 40 mg kg ip Cardiovascular responses to HBO2 were compared to delineate the sympathetic or parasympathetic contributions to changes in AP and HR In groups 6 8 aortic or carotid baroreceptors or both were A 0 10 20 30 60 50 40 30 20 10 0 10 Air 0 10 20 30 40 3 ATA O2 min 50 60 10 Air 0 10 20 30 40 50 60 3 ATA O2 min Fig 3 Hemodynamic responses in selectively baroreceptor denervated anesthetized rats in HBO2 at 3 ATA A in AD open squares and CD closed triangles rats MAP rose to higher levels during compression and declined more slowly during isopression than in intact animals closed circles but never returned to baseline in all 3 groups B HR fell below pre exposure levels in all 3 groups of rats after compression most rapidly in intact rats C and D changes in total cerebral blood flow tCBF and cerebral vascular resistance CVR were similar in all groups P 0 05 vs intact for AD P 0 05 vs intact for CD J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 74

Baroreflex Mediated Cardiovascular Responses to HBO2 expected BRS was diminished in AD and CD animals Fig 1A and nearly totally impaired in rats with complete baroreceptor deafferentation Fig 1B However of the 14 rats in which complete baroreceptor deafferentation was attempted three showed cardiovascular responses to PHE and nitroprusside indicating that baroreceptor deafferentation was incomplete data from these animals were not used Cardiovascular responses to HBO2 at 3 ATA In rats pretreated with vehicle MAP increased during O2 compression and declined by the end of the 60 min exposure but not to pre exposure levels Fig 2 In rats pretreated with phenoxybenzamine propranolol or tiotropium bromide pressor responses did not differ from those treated with vehicle alone L NAME pretreatment caused significantly smaller increases in MAP Fig 2 In selectively denervated rats MAP increased significantly more than in intact rats during compression and remained elevated until decompression Fig 3A HR trended downward in intact rats but changed little in AD or CD rats implicating the arterial baroreceptors in HR responses to HBO2 Fig 3B Changes in tCBF in intact AD and CD animals followed similar patterns decreasing below baseline in the first 30 min and then remaining relatively constant Fig 3C Calculated CVR was markedly higher in both intact rats and those with selective baroreceptor denervation consistent with A B 50 40 823 Conscious Rats Hemodynamic responses and baroreflex function In rats breathing room air selective baroreceptor denervation did not alter baseline values of MAP SAP and HR observed 5 7 days 30 10 0 20 10 10 20 0 30 D 20 10 10 Fig 4 Hemodynamic responses and renal sympathetic nerve activity RSNA in anesthetized rats in HBO2 at 3 ATA after complete baroreceptor deafferentation A and B MAP and mean HR were significantly higher with complete baroreceptor deafferentation open circles than in intact rats closed circles and did not decrease with time C and D changes in cardiac output CO and tCBF seen in animals with fully impaired baroreflexes tracked with changes seen in intact animals but at more elevated levels E RSNA rose significantly above baseline in the impaired group compared with a significant decline in intact rats F temporal profiles for systemic and cerebral vascular resistance SVR closed squares and CVR closed circles in intact rats were similar to those for rats with completely deafferented baroreceptors SVR open squares CVR open circles P 0 05 vs intact 0 0 10 10 20 20 30 E Demchenko IT et al increased MAP and diminished tCBF and reflecting a powerful hyperoxic vasoconstriction Fig 3D Animals with complete baroreceptor deafferentation showed greater increases in MAP and a slight tachycardia compared with the moderate hypertension and significant bradycardia seen in intact animals Fig 4 A and B In addition CO tCBF and RSNA were significantly greater than in the intact group Fig 4 C E but in both groups changes in calculated systemic and cerebral vascular resistance SVR and CVR tracked closely together Fig 4F Baroreflex function in HBO2 BRS was assessed in intact and completely deafferented animals by sequence analysis during O2 compression and by PHE injection during isopression MAP increased progressively during compression in both groups but was significantly higher in deafferented animals Fig 5A The baroreflex functioned properly in the intact rats but was impaired in rats with complete baroreceptor deafferentation as indicated by BRS assessed during compression Fig 5B and isopression Fig 6 20 30 C 30 30 F 20 60 50 10 40 0 30 10 20 20 10 30 0 10 Air 0 10 20 30 40 3 ATA O2 min 50 60 10 Air 0 10 20 30 40 50 60 3 ATA O2 min J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 75

824 Baroreflex Mediated Cardiovascular Responses to HBO2 Complete 140 120 Intact 100 80 Air 100 O2 compression 3 ATA O2 2 min 60 Time 8 6 4 2 0 5 10 15 We have shown that vasoconstriction arterial hypertension bradycardia and diminished CO the cardiovascular responses to hyperbaric hyperoxia at 2 5 or 3 ATA are linked by a baroreflex mediated mechanism Furthermore selective or complete deafferentation of the major arterial baroreceptors significantly increases the hypertension and attenuates or reverses the bradycardia that usually accompany hyperoxia at these pressures Baroreflex Function in Normoxia and Hyperoxia 10 0 DISCUSSION 20 25 30 SAP mmHg Fig 5 Arterial pressor responses and BRS in anesthetized rats during O2 compression A elevations in MAP during O2 compression are greater in rats with completely deafferented baroreceptors than in intact rats as shown in representative recordings of AP during compression to 3 ATA B BRS RR SAP is robust during the first 2 min of O2 compression in intact rats reflecting increases in SAP and RR intervals decreases in HR In rats with complete baroreceptor deafferentation the reduced slope of the regression line indicates baroreflex impairment after surgery but hemodynamic variability was greater Table 3 By contrast the same parameters were elevated significantly after complete baroreceptor deafferentation Table 3 However the bradycardia and tachycardia elicited by PHE and nitroprusside in intact rats were attenuated in selectively denervated rats and nearly abolished after complete baroreceptor deafferentation Table 3 During O2 compression to 2 5 ATA MAP increased in intact rats and then fell progressively during isopression but did not reach baseline before decompression MAP increased even more in selectively denervated rats and was highest in animals in which aortic and carotid baroreceptors were denervated Fig 7A In intact rats bradycardia began immediately with compression and persisted until decompression Selectively denervated rats showed no significant bradycardia whereas tachycardia occurred in rats with complete baroreceptor deafferentation Fig 7B Pressor responses to O2 compression were significantly greater in rats with complete baroreceptor deafferentation than in intact rats Fig 8A and baroreflex function was impaired Fig 8B During isopression BRS increased significantly in In normoxia the baroreflex responds to increases in AP that stimulate stretch receptors in the aortic arch and carotid sinuses Transduction of this mechanical stimulus increases the frequency of impulses relayed through afferent pathways to the nucleus tractus solitarius and ventrolateral medulla and these signals are processed further in other brain regions 20 Central integration of these inputs shifts autonomic equilibrium so that HR CO and SVR all decrease returning blood pressure to prestimulation levels These effects involve a vagally mediated reduction in HR and CO and an adrenergically mediated fall in peripheral resistance 19 The main new findings of the present study are that cardiovascular responses to HBO2 operate similarly through the arterial baroreceptor feedback loop to reduce cardiac rate and output AP also declines from its initial rise but does not return to baseline Arterial hypertension has been reported in most but not all animal and human studies during isopression in hyperbaric O2 1 3 6 16 22 23 27 44 46 47 but changes in AP during compression have not been investigated previously because such measurements are technically difficult especially in awake animals We were able to measure AP accurately during compression in anesthetized rats by using a paralytic agent to prevent motor or respiratory movements that could alter blood pressure In conscious rats light restraint permitted relatively 3 BRS bpm mmHg Arterial pressure mmHg 160 RR ms Demchenko IT et al intact rats compared with pre exposure levels in the same animals breathing room air but approached zero if baroreceptors were deafferented completely Fig 9 A 180 B 2 1 0 10 Air 0 10 20 30 40 50 60 3 ATA O2 min Fig 6 BRS in anesthetized rats in HBO2 at 3 ATA BRS HR MAP assessed by PHE injection every 10 min was elevated in intact rats black bars during the 60 min of HBO2 exposure but was impaired severely in animals with complete baroreceptor deafferentation gray bars The 0 time point indicates the beginning of the isopression phase P 0 05 for complete baroreceptor denervation vs intact J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 76

Baroreflex Mediated Cardiovascular Responses to HBO2 Demchenko IT et al 825 Table 3 Baseline hemodynamic parameters in conscious rats MAP mmHg SAP mmHg MAPV HR beats min HRV BRS bpm mmHg Values are means MAP change A SE Intact AD CD Complete 102 6 125 7 10 2 0 9 373 22 13 2 1 8 2 18 0 18 105 8 129 9 12 7 1 2 381 17 10 9 2 1 0 78 0 12 107 8 130 10 13 6 1 4 387 18 10 4 1 6 0 57 0 14 123 9 147 14 15 7 2 3 414 19 9 1 1 6 0 04 0 1 P 0 05 vs intact control 40 30 20 10 0 10 0 10 Air B 20 30 40 50 60 2 5 ATA O2 min 10 HR change 0 10 20 30 10 Air 0 10 20 30 40 50 60 2 5 ATA O2 min Fig 7 Temporal profiles of hemodynamic parameters in awake rats in HBO2 A the increase in MAP was significantly greater in rats with complete baroreceptor denervation open circles than in intact animals closed circles and did not fall with time In selectively baroreceptordenervated rats AD open squares CD closed triangles MAP responses to compression were similar to those in intact rats and trended downward within the isopression phase but did not return to baseline B after compression HR fell gradually below pre exposure levels in AD rats but declined profoundly in intact rats Rats with completely denervated baroreceptors showed no decrease in HR after compression P 0 05 for complete baroreceptor denervation vs intact artifact free recording although some unidentified intrinsic or environmental factors noise changes in temperature etc interfered occasionally The arterial pressor response began when the inspired gas was changed to 100 O2 and continued during O2 compression to 2 5 or 3 0 ATA Figs 5 and 8 Although AP responses were similar in both groups differences between anesthetized and conscious rats included baseline values of MAP SAP and HR after baroreceptor denervation as well as cardiovascular responses to HBO2 Also BRS an O2 independent index of cardiovascular function was higher in conscious rats than in anesthetized rats Fig 1 and Table 3 but no significant differences were observed between the two strains of rats The cause of hyperoxic hypertension has been attributed mainly to the increase in vascular resistance brought about by O2 induced vasoconstriction 4 6 7 17 46 Work done in our laboratories has identified a role for endothelium derived vasoactive products such as NO 2 11 12 31 41 49 In the present study increases in AP during O2 compression to 3 ATA were not affected by adrenergic or cholinergic receptor blockade but were significantly less after systemic NOS inhibition Fig 2 Thus hyperoxic vasoconstriction and increased vascular resistance at least partly reflect a decrease in the availability of NO but not neuronal effects Fig 2 However it is important to note that Mulkey et al 28 have shown in brain slices that CO2 H sensitive neurons in the solitary complex are selectively responsive to O2 at 1 680 or 2 470 Torr which in the intact brain are equivalent to higher levels of hyperoxia than we used At those more elevated levels of HBO2 it is possible that neuronal effects could influence respiratory responses in spontaneously breathing animals which in turn could result in additional vasoconstriction induced by hypocapnia or other mechanisms This needs further investigation However during O2 compression and the first few minutes of isopression levels of the superoxide anion rise and deplete NO by forming peroxynitrite 2 12 35 This could account for the elevation of AP in HBO2 and the baroreflex activation demonstrated here By definition the baroreflex responds to changes in AP including those induced by HBO2 Thus the pressor responses found here were mitigated when the baroreflex arc was intact and exacerbated when it was not and complete deafferentation resulted in persistent hypertension Table 2 Moreover selective baroreceptor deafferentation provoked immediate hypertension in rats breathing room air demonstrating that basal barosensory activity holds AP in check but 2 h later AP was similar to that in intact animals suggesting that the remaining baroreceptor function suffices to inhibit increased sympathetic activity Although hemodynamic parameters in selectively deafferented rats and intact rats were similar in room air their J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 77

826 Baroreflex Mediated Cardiovascular Responses to HBO2 40 MAP change 30 20 10 0 0 20 40 60 80 100 120 140 O2 compression to 2 5 ATA s B 10 RR ms 8 6 4 2 0 0 5 10 15 20 25 30 35 SAP mmHg Fig 8 Arterial pressor responses and BRS in awake rats during O2 compression A O2 compression raises MAP more profoundly in rats with complete baroreceptor deafferentation open circles than in intact rats closed circles Each point represents responses averaged over 5 s B complete baroreceptor deafferentation severely impairs BRS RR SAP during O2 compression in spite of marked increases in MAP responses to O2 compression were significantly different Disparities were even greater after complete baroreceptor deafferentation including a stronger pressor response and relatively persistent elevations in AP during isopression demonstrating that intact arterial baroreceptors buffer hyperoxic hypertension Although hyperoxic bradycardia in HBO2 at 2 5 or 3 ATA is associated with arterial baroreceptor activation some bradycardia persisted after total baroreceptor deafferentation suggesting that other mechanisms located elsewhere in the vasculature continue to operate These could include decreased peripheral chemoreceptor activity or direct effects of O2 or pressure per se on the sinus node 16 39 but none of these effects could contribute more than a small fraction of the negative chronotropic response observed in intact animals Effectiveness of the Baroreflex in HBO2 Physiologically the baroreflex responds to stimuli that increase AP abruptly for example vasoconstriction due to sympathetic activation When this happens the arterial baroreceptor feedback loop restores AP to control levels through Demchenko IT et al negative chronotropic and inotropic effects resulting from parasympathetic vagal activation as well as decreases in peripheral vascular resistance as sympathoexcitation is withdrawn Although the sympathetic limb of the baroreflex is the most effective means for modulating peripheral resistance 43 the overall efficiency of the baroreflex is inferred commonly from the parasympathetic HR response because it is easier to measure As we show here however the baroreflex is triggered in HBO2 by a vasoconstriction that is not due to sympathetic activation In this case the baroreflex acts mainly through its vagal parasympathetic limb as manifested by a profound bradycardia without significant decreases in regional or systemic vascular resistance Figs 3 and 4 We also made the important observations that HBO2 increases BRS significantly during the isobaric phase of exposure to hyperbaric O2 that this is associated with bradycardia and a decrease in RSNA and that these responses are nearly eliminated by total deafferentation of the arterial baroreceptors demonstrating the importance of these pathways Although much of the cardiovascular response to HBO2 at 2 5 and 3 ATA results from an intact baroreflex responding to peripheral vasoconstriction hyperoxic hypertension is not fully reversed in spite of bradycardia and diminished CO There are at least two reasons for this First the more effective limb of the baroreflex which can decrease peripheral vascular resistance by withdrawing sympathetic tone is not available in HBO2 because hyperoxic vasoconstriction observed in this study did not appear to be neuronal in origin Second the baroreflex can adapt or reset even after a brief hypertensive episode 43 as shown by in vitro studies in which single fiber aortic baroreceptor activity declines exponentially with a time constant of 3 4 min when a step rise in AP is maintained 29 Such resetting can result from changes in the afferent central or efferent components of the arterial baroreflex loop 19 43 We draw two conclusions from this study First the acute cardiovascular changes that occur in moderate levels of hyperbaric O2 3 ATA can be explained by a common mechanism activation of the arterial baroreflex triggered by a rise in AP due to hyperoxic vasoconstriction Second the resulting afferent discharges from the arterial baroreceptors evoke central responses that suppress efferent sympathetic activity and augment parasympathetic outflow Thus HBO2 is not only an efficient means for enhancing the delivery of O2 to tissues but can also be thought of as a means for modulating the activity 3 RR SAP ms mmHg A 2 1 0 20 10 Air 0 10 20 30 40 50 60 2 5 ATA O2 min Fig 9 BRS in awake rats A BRS RR SAP was elevated in intact rats closed circles throughout the 60 min of HBO2 at 2 5 ATA but was impaired by complete baroreceptor deafferentation open circles Time 0 indicates the beginning of the isopression phase J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 78

Baroreflex Mediated Cardiovascular Responses to HBO2 of the autonomic nervous system The implications of this insight have yet to be explored fully and could include new therapies for diseases in which excessive sympathoexcitation is a factor GRANTS Support for this work was sponsored by the Office of Naval Research Grant N00014 11 1 0040 to C A Piantadosi and the Russian Federation for Basic Research Grant 12 04 01446a to I T Demchenko DISCLOSURES The authors declare no conflicts of interest AUTHOR CONTRIBUTIONS Author contributions I T D A I K C A P and B W A conception and design of research I T D S Y Z A N M and A I K performed experiments I T D S Y Z A N M A I K and B W A analyzed data I T D S Y Z A N M A I K C A P and B W A interpreted results of experiments I T D and B W A prepared figures I T D and B W A drafted manuscript I T D C A P and B W A edited and revised manuscript I T D S Y Z A N M A I K C A P and B W A approved final version of manuscript REFERENCES 1 Abel FL McNamee JE Cone DL Clarke D Tao J Effects of hyperbaric oxygen on ventricular performance pulmonary blood volume and systemic and pulmonary vascular resistance Undersea Hyperb Med 27 67 73 2000 2 Atochin DN Demchenko IT Astern J Boso AE Piantadosi CA Huang PL Contributions of endothelial and neuronal nitric oxide synthases to cerebrovascular responses to hyperoxia J Cereb Blood Flow Metab 23 1219 1226 2003 3 Bean JW Rottschafer G Reflexogenic and central structures in oxygen poisoning J Physiol 94 294 306 1938 4 Berg GW Tyssebotn I Cardiovascular effects of hyperbaric oxygen with and without addition of carbon dioxide Eur J Appl Physiol Occup Physiol 80 264 275 1999 5 Bernardi L Roseng rd B rlund M Sandelin A M kinen V Forsblom C Groop PH Short term oxygen administration restores blunted baroreflex sensitivity in patients with type 1 diabetes Diabetologia 54 2164 2173 2011 6 Berry JM Doursout MF Butler BD Effects of hyperbaric hyperoxia on cardiac and regional hemodynamics in conscious dogs Aviat Space Environ Med 69 761 765 1998 7 Bulte DP Chiarelli PA Wise RG Jezzard P Cerebral perfusion response to hyperoxia J Cereb Blood Flow Metab 27 69 75 2007 8 Chan RKW Jarvina EV Sawchenko PE Effects of selective sinoaortic denervations on phenylephrine induced activational responses in the nucleus of the solitary tract Neuroscience 101 165 178 2000 9 Dallinger S Dorner GT Wenzel R Graselli U Findl O Eichler HG Wolzt M Schmetterer L Endothelin 1 contributes to hyperoxia induced vasoconstriction in the human retina Invest Ophthalmol Vis Sci 41 864 869 2000 10 Daly WJ Bondurant S Effects of oxygen breathing on the heart rate blood pressure and cardiac index of normal men resting with reactive hyperemia and after atropine J Clin Invest 41 126 132 1962 11 Demchenko IT Boso AE Bennett PB Whorton AR Piantadosi CA Hyperbaric oxygen reduces cerebral blood flow by inactivating nitric oxide Nitric Oxide 4 597 608 2000 12 Demchenko IT Oury TD Crapo JD Piantadosi CA Regulation of the brain s vascular responses to oxygen Circ Res 91 1031 1037 2002 13 Demchenko IT Ruehle A Allen BW Vann RD Piantadosi CA Phosphodiesterase 5 inhibitors oppose hyperoxic vasoconstriction and accelerate seizure development in rats exposed to hyperbaric oxygen J Appl Physiol 106 1234 1242 2009 14 Demchenko IT Zhilyaev SY Moskvin AN Piantadosi CA Allen BW Autonomic activation links CNS oxygen toxicity to acute cardiogenic pulmonary injury Am J Physiol Lung Cell Mol Physiol 300 L102 L111 2011 15 Eggers GWN Paley HW Leonard JJ Warren JV Hemodynamic responses to oxygen breathing in man J Appl Physiol 17 75 79 1962 Demchenko IT et al 827 16 Fagraeus L Linnarsson D Autonomic origin of heart rate fluctuations at the onset of muscular exercise J Appl Physiol 40 679 682 1976 17 Floyd TF Clark JM Gelfand R Detre JA Ratcliffe S Guvakov D Lambertsen CJ Eckenhoff RG Independent cerebral vasoconstrictive effects of hyperoxia and accompanying arterial hypocapnia at 1 ATA J Appl Physiol 95 2453 2461 2003 18 Gole Y Gargne O Coulange M Steinberg JG Bouhaddi M Jammes Y Regnard J Boussuges A Hyperoxia induced alterations in cardiovascular function and autonomic control during return to normoxic breathing Eur J Appl Physiol 111 937 946 2011 19 Guyenet PG The sympathetic control of blood pressure Nat Rev Neurosci 7 335 346 2006 20 Henderson LA Richard CA Macey PM Runquist ML Yu PL Galons JP Harper RM Functional magnetic resonance signal changes in neural structures to baroreceptor reflex activation J Appl Physiol 96 693 703 2004 21 Jackson WF Arteriolar oxygen reactivity where is the sensor Am J Physiol 253 H1120 H1126 1987 22 Kenmure AC Murdoch WR Hutton I Cameron AJ Hemodynamic effects of oxygen at 1 and 2 ATA pressure in healthy subjects J Appl Physiol 32 223 226 1972 23 Larsson A Uusij rvi J Eksborg S Lindholm P Tissue oxygenation measured with near infrared spectroscopy during normobaric and hyperbaric oxygen breathing in healthy subjects Eur J Appl Physiol 109 757 761 2010 24 Lodato RF Jubran A Response time autonomic mediation and reversibility of hyperoxic bradycardia in conscious dogs J Appl Physiol 74 634 642 1993 25 Lund V Laine J Laitio T Kentala E Jalonen J Scheinin H Instantaneous beat to beat variability reflects vagal tone during hyperbaric hyperoxia Undersea Hyperb Med 30 29 36 2003 26 Mathieu D Favory R Collet F Linke JC Wattel F Physiologic effects of hyperbaric oxygen on hemodynamics and microcirculation In Handbook on Hyperbaric Medicine edited by Dordrecht MD Heidelberg Germany Springer Netherlands 2006 p 75 101 27 Mol nat F Boussuges A Grandfond A Rostain JC Sainty JM Robinet C Galland F Meliet JL Haemodynamic effects of hyperbaric hyperoxia in healthy volunteers an echocardiographic and doppler study Clin Sci Lond 106 389 395 2004 28 Mulkey DK Henderson RA Putnam RW Dean JB Hyperbaric oxygen and chemical oxidants stimulate CO2 H sensitive neurons in rat brain stem slices J Appl Physiol 95 910 921 2003 29 Munch PA Brown AM Sympathetic modulation of rabbit aortic baroreceptors in vitro Am J Physiol Heart Circ Physiol 253 H1106 H1111 1987 30 Neubauer B Tetzlaff K Staschen CM Bettinghausen E Cardiac output changes during hyperbaric hyperoxia Int Arch Occup Environ Health 74 119 122 2001 31 Oury TD Ho Y Piantadosi CA Crapo JD Extracellular superoxide dismutase nitric oxide and central nervous system o2 toxicity Proc Natl Acad Sci USA 89 9715 9719 1992 32 Pasgaard T Stankevicius E J rgensen MM stergaard L Simonsen U Fr bert O Hyperoxia reduces basal release of nitric oxide and contracts porcine coronary arteries Acta Physiol Oxf 191 285 296 2007 33 Piantadosi CA Pulmonary gas exchange oxygen transport and tissue oxygenation In Physiology and Medicine of Hyperbaric Oxygen Therapy edited by Neuman TS and Thom SR Philadelphia W B Saunders 2008 chapt 8 p 133 158 34 Rousseau A Tesselaar E Henricson J Sj berg F Prostaglandins and radical oxygen species are involved in microvascular effects of hyperoxia J Vasc Res 47 441 450 2010 35 Rubanyi GM Vanhoutte PM Superoxide anions and hyperoxia inactivate endothelium derived relaxing factor Am J Physiol Heart Circ Physiol 250 H822 H827 1986 36 Savitt MA Rankin JS Elberry JR Owen CH Camporesi EM Influence of hyperbaric oxygen on left ventricular contractility total coronary blood flow and myocardial oxygen consumption in the conscious dog Undersea Hyperb Med 21 169 183 1994 37 Schreihofer AM Sved AF Use of sinoaortic denervation to study the role of baroreceptors in cardiovascular regulation Am J Physiol 266 R1705 R1710 1994 J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 79

828 Baroreflex Mediated Cardiovascular Responses to HBO2 38 Shibata S Iwasaki Ki Ogawa Y Kato J Ogawa S Cardiovascular neuroregulation during acute exposure to 40 70 and 100 oxygen at sea level Aviat Space Environ Med 76 1105 1110 2005 39 Shida KK Lin YC Contribution of environmental factors in development of hyperbaric bradycardia J Appl Physiol 50 731 735 1981 40 Smyth HS Sleight P Pickering GW Reflex regulation of arterial pressure during sleep in man a quantitative method of assessing baroreflex sensitivity Circ Res 24 109 121 1969 41 Stamler JS Jia L Eu JP McMahon TJ Demchenko IT Bonaventura J Gernert K Piantadosi CA Blood flow regulation by S nitrosohemoglobin in the physiological oxygen gradient Science 276 2034 2037 1997 42 Stauss HM Moffitt JA Chapleau MW Abboud FM Johnson AK Baroreceptor reflex sensitivity estimated by the sequence technique is reliable in rats Am J Physiol Heart Circ Physiol 291 H482 H483 2006 43 Thrasher TN Baroreceptors baroreceptor unloading and the long term control of blood pressure Am J Physiol Regul Integr Comp Physiol 288 R819 R827 2005 44 Torbati D Parolla D Lavy S Organ blood flow cardiac output arterial blood pressure and vascular resistance in rats exposed to various oxygen pressures Aviat Space Environ Med 50 256 263 1979 Demchenko IT et al 45 Waring WS Thomson AJ Adwani SH Rosseel AJ Potter JF Webb DJ Maxwell SRJ Cardiovascular effects of acute oxygen administration in healthy adults J Cardiovasc Pharmacol 42 245 250 2003 46 Weaver LK Howe S Snow GL Deru K Arterial and pulmonary arterial hemodynamics and oxygen delivery extraction in normal humans exposed to hyperbaric air and oxygen J Appl Physiol 107 336 345 2009 47 Whalen RE Saltzman HA Holloway DH Jr McIntosh HD Sieker HO Brown IW Jr Cardiovascular and blood gas responses to hyperbaric oxygenation Am J Cardiol 15 638 646 1965 48 Wolin MS Ahmad M Gupte SA Oxidant and redox signaling in vascular oxygen sensing mechanisms basic concepts current controversies and potential importance of cytosolic nadph Am J Physiol Lung Cell Mol Physiol 289 L159 L173 2005 49 Zhilyaev SY Moskvin AN Platonova TF Gutsaeva DR Churilina IV Demchenko IT Hyperoxic vasoconstriction in the brain is mediated by inactivation of nitric oxide by superoxide anions Neurosci Behav Physiol 33 783 787 2003 J Appl Physiol doi 10 1152 japplphysiol 00625 2013 www jappl org Downloaded from journals physiology org journal jappl 172 225 245 101 on October 12 2022

Page 80

Research Article Acute Biochemical Cardiovascular and Autonomic Response to Hyperbaric 4 atm Exposure in Healthy Subjects Mariusz Kozakiewicz 1 Joanna Slomko 2 Katarzyna Buszko 3 Wladyslaw Sinkiewicz 4 Jacek J Klawe 2 Malgorzata Tafil Klawe 5 Julia L Newton 6 and Pawel Zalewski 2 1 Department of Food Chemistry Nicolaus Copernicus University in Torun Ludwik Rydygier Collegium Medicum in Bydgoszcz D bowa 3 85 626 Bydgoszcz Poland 2 Department of Hygiene Epidemiology and Ergonomics Nicolaus Copernicus University in Torun Ludwik Rydygier Collegium Medicum in Bydgoszcz M Sklodowskiej Curie 9 85 094 Bydgoszcz Poland 3 Department of Theoretical Foundations of Bio Medical Sciences and Medical Informatics Nicolaus Copernicus University in Torun Ludwik Rydygier Collegium Medicum in Bydgoszcz Jagiellonska 13 85 067 Bydgoszcz Poland 4 2nd Department of Cardiology Nicolaus Copernicus University in Torun Ludwik Rydygier Collegium Medicum in Bydgoszcz Ujejskiego 75 85 168 Bydgoszcz Poland 5 Department of Human Physiology Nicolaus Copernicus University in Torun Ludwik Rydygier Collegium Medicum in Bydgoszcz Kar owicza 24 85 092 Bydgoszcz Poland 6 Institute for Ageing and Health The Medical School Newcastle University Framlington Place Newcastle upon Tyne NE2 4HH UK Correspondence should be addressed to Mariusz Kozakiewicz markoz cm umk pl Academic Editor Ki Wan Oh Copyright 2018 Mariusz Kozakiewicz et al This is an open access article distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited The aim of this study was to explore the effect of a hyperbaric environment alone on the cardiovascular system by ensuring elimination of factors that may mask the effect on hyperbaria The research was performed in a hyperbaric chamber to eliminate the effect of physical activity and the temperature of the aquatic environment Biochemical analysis and examination with the Task Force Monitor device were performed before and immediately after exposure TFM was used for noninvasive examination of the cardiovascular system and the functional evaluation of the autonomic nervous system Natriuretic peptides were measured as biochemical markers which were involved in the regulation of haemodynamic circulation vasoconstriction urotensin II Larginine acted as a precursor of the level of the nitric oxide whereas angiotensin II and angiotensin 1 7 were involved in cardiac remodeling The study group is comprised of 18 volunteers who were professional divers of similar age and experience The results shown in our biochemical studies do not exceed reference ranges but a statistically significant increase indicates the hyperbaric environment is not without impact upon the human body A decrease in HR an increase in mBP dBP and TPR and increase in parasympathetic heart nerves activity suggest an increase in heart afterload with a decrease in heart activity within almost one hour after hyperbaric exposure Results confirm that exposure to a hyperbaric environment has significant impact on the cardiovascular system This is confirmed both by changes in peptides associated with poorer cardiovascular outcomes where a significant increase in the studied parameters was observed and by noninvasive examination 1 Introduction Diving exposes a body to an unnatural hyperbaric environment which can lead to increased gas dissolved in the tissues 1 Gas solubility in tissues is a very complex process which cannot be described using Henry s law being a law used for gas solubility in liquids It is a process for which Dalton s law of partial pressure needs to be taken into consideration and also includes gas solubility in a complex phase system meaning law of gas solubility in two immiscible liquids Additional issue is the usage of saturation and dehydration of the tissues which show the speed with which these processes occur and mechanisms of the creation of microbubbles of gas

Page 81

2 Evidence Based Complementary and Alternative Medicine Table 1 Demographics of the study group Hyperbaric exposure 18 Characteristic Age years Body mass kg Body height m Body Mass Index kg m2 Heart Rate at rest min sBP at rest mmHg dBP at rest mmHg mBP at rest mmHg diving experience years The complexity of these processes which take place in the diver s organism during descending and ascending does not allow for its full theoretical description 1 2 In a clinical setting hyperbaric oxygen treatment is used for treatment of decompression sickness carbon monoxide poisoning gas gangrene soft tissue 3 5 postradiation burns and treatment of poorly healing wounds 6 Studies have also investigated the use of HBO after radiation or chemotherapy 7 8 and today there are many clinical indications for the use of HBO therapy 9 Another form of hyperbaric exposure is the long term frequent exposure to high external pressure observed among professional divers This type of diving usually takes place at a significant depths and lasts much longer than recreational diving When subjected to a hyperbaric environment divers bodies experience factors that may influence haemodynamic and cardiovascular CV system function 10 11 The work of a professional diver is therefore associated with stress related not only to exposure to a hyperbaric environment but also to heavy physical work This leads to among other things an increased heart rate and pressure variations in the respiratory tract affecting the chest and the venous return 11 12 The adaptive mechanisms in the CV system that occur during diving remain unclear 12 Ongoing studies suggest that diving is associated with changes in oxidative stress and the increased expression of regulatory proteins 13 the consequences of which are unclear Changes in CV function after recreational or professional diving have been observed in many studies but it has frequently been concluded that confounding factors such as physical activity or temperature are the cause of any changes detected 14 15 The aim of this study was to explore the effect of a hyperbaric environment alone by ensuring elimination of factors that may mask the effect The research was performed in a hyperbaric chamber to eliminate the effect of physical activity and the temperature of the aquatic environment In addition biochemical analysis was performed on natriuretic peptides BNP and ANP involved in the regulation of haemodynamic circulation 16 19 and vasoconstriction urotensin II 20 the level of the endogenic amino acid and the nitrogen oxide precursor L arginine 21 23 and measurement of parameters involved in cardiac remodeling angiotensin II and angiotensin 1 7 24 28 31 1 5 9 82 9 13 4 1 79 0 08 25 6 2 7 70 2 9 1 118 8 12 72 6 6 8 91 8 2 8 7 4 3 All cardiovascular response mechanisms of the cardiovascular system are integrated and regulated by the autonomic nervous system Thus the analysis of heart rate and blood pressure variability allows determining the activity and reactivity of autonomic nervous system noninvasively 2 Material and Methods This study was carried out in accordance with the recommendations of the Bioethics Commission of the Collegium Medicum in Bydgoszcz of Nicolaus Copernicus University in Torun with written informed consent from all subjects All subjects gave written consent in accordance with the Declaration of Helsinki The protocol was approved by the Bioethics Commission of the Collegium Medicum in Bydgoszcz of Nicolaus Copernicus University in Torun 2 1 Subjects The study group is comprised of 18 men volunteers that agreed to take part in the research with a mean age of 31 1 5 9 years working on average for 8 7 4 3 years as professional divers Before the experiment all volunteers declared in a questionnaire that they did not smoke or drink alcohol Furthermore 72 hours prior to the experiment the volunteers did not do any excessive physical activity Anthropometric parameters for the study group are shown in Table 1 2 1 1 Hyperbaric Exposure Hyperbaric exposures were performed at the Department of Diving Equipment and Technologies for Underwater Works Polish Naval Academy in Gdynia at the hyperbaric chambers complex DKN 120 The exposures were performed by qualified personnel Before and after each exposure the subject underwent a full medical examination The use of the hyperbaric chamber allowed creating comparable exposure conditions to be created for all subjects The expositions in hyperbaric chamber were performed in three person groups Factors such as a breathing gas used physical exercise ambient temperature and humidity were monitored in all experiments and then were registered throughout the exposure All subjects used air as a breathing gas and were not exposed to physical exercise The exposure conditions imitated pressure conditions during diving to 30 meters of sea water

Page 82

Evidence Based Complementary and Alternative Medicine 3 Table 2 Biochemical analysis results before and after hyperbaric exposure The mean values of standard deviation were presented Parameter before exposure L Arginine ARG g mL Brain natriuretic peptide BNP pg mL Atrial natriuretic peptide ANP pg mL Angiotensin ANG pg mL Angiotensin 1 7 ANG 1 7 ng mL Urotensin II URO II ng ml 87 1 17 7 33 21 9 37 8 24 4 7 0 7 327 117 1 119 6 47 6 TIME minutes 0 1 9 17 25 33 41 49 57 DEPTH meters 5 10 15 Decompression steps I 6 minutes at 9 m II 10 minutes at 6 m III 16 minutes at 3 m 20 25 30 35 Plateau at the depth 30 meters Figure 1 The depths and durations of the decompression stops The volunteers were placed in a hyperbaric chamber and exposed to compression of 40 MPa total pressure was 0 4 MPa 0 3 MPa in the chamber 0 1 MPa of the atmospheric pressure The exposure plateau was equal to ca 30 minutes followed by gradual decompression according to the decompression tables of the Polish Navy Figure 1 For safety reasons and in order for the side effects to be minimalised e g bends after exposure to 30 meters the decompression pattern used resembled that followed after diving to 33 meters 2 1 2 Biochemical Parameters Blood collected in the antecubital vein was used for biochemical analyses Samples were collected in tubes without anticoagulant approx 3 mL to obtain serum for BNP ANP angiotensin angiotensin 1 7 and urotensin II determinations Vacuette Greiner Bio One Plasma obtained from blood collected from the same vein on anticoagulant being 2 ml of EDTA was used to determine L arginine levels Then serum was separated by centrifuging at 2500 g at 4 C for 15 minutes Serum and plasma were frozen at 80 C and stored until used for determinations All parameters were determined using commercially available ELISA kits Cloud Clone Corp USA in accordance with the instruction provided with each kit 2 1 3 Cardiovascular and Autonomic Parameters Before and immediately after the exposure the volunteers underwent an examination with the Task Force Monitor TFM CNSystems Hyperbaric exposure 18 subjects after exposure 75 4 15 3 46 5 27 1 47 2 26 6 4 4 0 6 266 7 98 8 91 2 35 5

Page 83

4 Evidence Based Complementary and Alternative Medicine Table 3 Cardiovascular function before after hyperbaric exposure The mean values of standard deviation were presented Parameter before exposure HR 1 sBP mmHg dBP mmHg mBP mmHg SI ml m2 CI l min m2 TPRI dyn s m2 cm5 IC 1000 s ACI 100 s2 HI 1 s2 LVWI mmHg l min m2 LVET ms PEP ms ER 70 2 9 1 118 8 12 72 6 6 8 91 8 2 54 4 11 1 3 8 0 9 1995 8 667 63 18 2 85 3 28 8 0 4 0 1 4 6 1 2 312 6 12 5 105 4 12 9 36 4 3 7 Hyperbaric exposure 18 subjects after exposure 60 7 7 2 123 6 10 3 77 8 7 2 96 8 53 8 9 9 3 2 0 6 2429 2 681 9 60 3 16 4 79 1 25 7 0 3 0 1 4 1 0 8 323 3 15 1 109 6 10 5 32 5 2 7 0 0002 0 0526 0 0013 0 0032 0 5565 0 0018 0 0028 0 2310 0 1226 0 1329 0 0477 0 0015 0 0385 0 0002 Figure 2 Subjects percentage indicators of the increase and decrease of the autonomic parameters LFnu RRI HFnu RRI PSD RRI LF HFRRI LF HF LFnu dBP HFnu dBP PSD dBP LF HF dBP LFnu sBP HFnu sBP PSD sBP and LF HF sBP mean arterial blood pressure with a parallel increase in total peripheral resistance after hyperbaric exposure In addition left ventricle work index parameter significantly changed with reductions in left ventricular work index and ejection rate and increases in left ventricular ejection time and preejection time Data in Figure 2 and Table 3 presented percentage indicators of the increase and decrease of the cardiovascular function elevated in HF component and thus sympathovagal balance was decreased in response to hyperbaric exposure or and hyperoxia or a combination of both There were no significant changes in baroreceptors reflex sensitivity in all sequences as significant decrease was observed in numbers of detected baroreceptor measures Table 4 shows percentage indicators of the increase and decrease of the autonomic function indicators 3 3 Autonomic and Baroreceptors Parameters When we explored changes in heart rate and blood pressure variability on hyperbaric exposure we showed a significant reduction in low frequency parameters largely sympathetic and increase in high frequency largely parasympathetic with an associated shift in sympathovagal balance after hyperbaric exposure The LF HF ratios calculated from all bands of heart rate variability and blood pressure variability were 4 Discussion This study has confirmed that exposure to a hyperbaric environment has a significant impact on the cardiovascular system This is confirmed both by changes in peptides associated with poorer cardiovascular outcomes where a significant increase in the studied parameters was observed and by noninvasive examination with the TFM system

Page 84

Evidence Based Complementary and Alternative Medicine 5 Table 4 Autonomic and baroreceptors function before after hyperbaric exposure The mean values of standard deviation were presented Parameter before exposure Heart rate variability LFnu RRI HFnu RRI PSD RRI ms2 LF HF RRI 1 LF HF 1 Diastolic blood pressure variability LFnu dBP HFnu dBP PSD dBP mmHg2 LF HF dBP 1 Systolic blood pressure variability LFnu sBP HFnu sBP PSD sBP mmHg2 LF HF sBP 1 Baroreceptors reflex sensitivity Up Events 1 Down Events 1 Total Events 1 Up Events Slope ms mmHg Down Events Slope ms mmHg Total Events Slope ms mmHg 62 14 1 38 14 1 2218 5 2387 2 2 1 3 1 8 0 8 54 5 12 10 9 7 1 9 5 6 7 5 4 6 48 6 14 1 15 8 10 3 12 8 9 9 4 9 4 Hyperbaric exposure 18 after exposure 45 6 20 54 4 20 2850 5 2885 2 1 4 1 4 1 1 1 2 40 7 18 5 19 9 14 4 8 7 7 1 3 7 3 0 0013 0 0013 0 0279 0 0123 0 0156 0 0065 0 0222 0 4724 0 0057 38 2 19 5 22 1 12 11 4 8 2 2 5 1 9 0 0222 0 0123 0 5861 0 0006 26 6 13 3 0 3061 12 8 9 1 11 9 9 3 24 8 18 1 6 5 5 5 1 5 5 11 1 10 7 0 0008 0 0026 0 0065 16 2 8 9 22 3 11 5 0 0597 27 1 22 22 6 15 3 In the experiment the influence of other factors such as physical activity or stress associated with being in water hypothermia energy needed for sustaining physical activity which is connected with the increased oxygen consumption was minimised This is of particular importance as previous studies have reported similar changes as those seen in the current study but changes have been interpreted as being the effect of stress caused by being underwater the ambient temperature and the physical activity of the divers 32 34 Despite intense studies conducted in recent years the authors have not found a publication presenting such results concerning the direct effect of external pressure on the cardiovascular system Previous studies have confirmed an increase in the level of type B natriuretic peptide observed after diving 35 37 It is important to note that a significant increase in BNP or proBNP after exposure to HBO observed in these papers was interpreted as occurring because of physical exercise however in our experiment this factor was eliminated and still we observed a statistically significant increase that was within a population reference range for that factor Our results support the following mechanism typical also for water immersion exposure to pressure in hyperbaric chambers results in an increase in intrathoracic blood volume causing dieresis because of a release of natriuretic hormones and suppression of antidiuretic hormone 38 40 24 7 10 8 0 2485 We also found that the hyperbaric environment causes an L Arg change which has influence on nitric oxide NO production in vessel endothelium Endothelium derived nitric oxide seems to be released as free NO radical or in a more stable form interactions with thiol or non haem iron ligands Under resting conditions of flow NO provides a constant vasodilator tone acting against sympathetic vasoconstriction Following changes in environment increased shear stress during blood shifts NO synthesis can be stimulated to provide a mechanism for the local regulation of vascular tone and blood flow 41 42 Observation showing the absence of microvascular vasoconstriction during hyperbaric hyperoxic conditions also supports our interpretation 43 It is worth mentioning that we also observed a decrease in urotensin II secretion in the hyperbaric environment Urotensin II is considered to be the most effective vasoconstrictor and it appears that it can be manipulated in the hyperbaric environment There seems to be a balance between endothelium independent vasoconstriction and endothelium dependent vasodilatation urotensin II NO 44 Our study has confirmed that exposure to hyperbaric pressure has no significant effect on angiotensin Ang but we did find a decrease in Ang 1 7 It is well known that nitric oxide NO release is promoted by Ang 1 7 through activation of endothelial NO synthase eNOS and neuronal

Page 85

6 NO synthase A few studies have shown a significant vasodilator effect of Ang 1 7 in isolated cardiomyocytes Great part of the research concerning Ang 1 7 or other agonists in the heart puts strong emphasis on its cardioprotective effects 45 A significant reduction of ischemia reperfusion is produced mainly by low concentrations of Ang 1 7 Even though Ang 1 7 is formed it is observed that the blood vessels are of the major areas where the above mentioned low concentrations occur Vasodilation in aortic rings and in several vascular territories is produced by Ang 1 7 the effect of which leads to a decrease in total peripheral resistance with a consequent increase in cardiac output These essentially equivalent alterations have hemodynamic effect on blood pressure leading to no net change in blood pressure A right ventricular overload being an impairment of ventricular diastolic performance may be observed as an indication of the fact that circulating gas bubbles during decompression are associated with cardiac changes There is a hypothesis of silent gas bubbles damaging pulmonary endothelium and activating the reactive systems of the human body with which the changes in biochemical parameters are consistent 38 39 46 48 The results shown in our biochemical studies do not exceed reference ranges however a statistically significant increase indicates the hyperbaric environment is not without potential impact upon the human body A decrease in HR an increase in mBP dBP and TPR and increase in parasympathetic heart nerves activity suggest an increase in heart afterload with a decrease in heart activity HR and contractility almost one hour after hyperbaric exposure These prolonged effects seem to be related to resetting of different cardiovascular reflex mechanisms activated by mechanical stimulus hyperbaric pressure resulting in central blood shifts and higher levels in parameters concerning central venous pressure increase in heart preload Changes of sympathoparasympathetic balance of heart innervation with increased vascular resistance increase in sympathetic vascular drive indicate changes of regulatory pattern in cardiovascular system This difficult hard haemodynamic situation helps to explain cardiac disorders and an unexpected decease during diving activities It is noticed that divers whose age ranges from 60 to 70 years are highly probable to suffer from diving related deaths resulting from cardiovascular disease 12 49 51 The decrease in respiratory cardiac arrhythmia in subjects from this age group indicates the decrease in tonic cardiac parasympathetic activity Bradycardia found in our study might be considered as a protective effect on cardiac muscle in hyperbaric condition Our result confirms importance of being properly examined by a medical practitioner before diving The requirements for that activity differ depending on the purpose of diving itself for military divers they are more stringent than for recreational divers Hyperbaric chamber workers caisson and tunnel workers all should have unique standards The crucial element in those requirements especially in the sport and work diving community is a thorough verification of diving candidates for the presence of a coronary disease Those with an increased risk for coronary Evidence Based Complementary and Alternative Medicine disease due to age and chronic illness metabolic should not be selected for this type of activity We would conclude that further studies are required to explore whether in long term professional divers who are undergoing deep hyperbaric exposures experience delayed effects particularly related to cardiovascular diseases such as LVH Abbreviations ACI ANP BNP BSA CI contBP CV dBP ECG eNOS ER HF HFnu HI HR IC ICG LF LFnu LVET LVWI mBP NO oscBP PEP PSD sBP SI TFM TPR TPRI URO II Acceleration index Atrial natriuretic peptide Brain natriuretic peptide Body surface area Cardiac index Continuous blood pressure Cardiovascular Diastolic blood pressure Electrocardiogram Nitric oxide synthase 3 Early ejection High frequency Normalised units high frequency Heather index Heart rate Index of contractility Impedance cardiography Low frequency Normalised units low frequency Left ventricular ejection time Left ventricular work index Mean blood pressure Nitric oxide Oscillometric blood pressure Aortic preejection period Power spectral density Systolic blood pressure Stroke index Task Force Monitor Total peripheral resistance Total peripheral resistance index Urotensin II Data Availability The datasets generated and or analyzed during the current study are available from the corresponding author upon request from other scientists Conflicts of Interest All authors declare no conflicts of interest Acknowledgments This work was supported by the funds of Collegium Medicum Nicolaus Copernicus University

Page 86

Evidence Based Complementary and Alternative Medicine References 1 P B Bennett and D H Elliott The Physiology and medicine of diving London Carson Calif USA 3rd edition 1982 2 A Spira Diving and marine medicine review Part I Diving physics and physiology Journal of Travel Medicine vol 6 no 1 pp 32 44 1999 3 B T Byrne Variability in hyperbaric oxygen treatment for acute carbon monoxide poisoning Undersea Hyperbaric Medicine vol 39 no 2 pp 627 38 2012 4 L Domachevsky Y Adir M Grupper Y Keynan and Y Bentur Hyperbaric oxygen in the treatment of carbon monoxide poisoning Clinical Toxicology vol 43 no 3 pp 181 188 2005 5 M P Fielden E Martinovic and A L Ells Hyperbaric oxygen therapy in the treatment of orbital gas gangrene Journal of American Association for Pediatric Ophthalmology and Strabismus vol 6 no 4 pp 252 254 2002 6 D W Anderson Using hyperbaric oxygen therapy to heal radiation wounds Nursing vol 33 no 9 pp 50 53 2003 Camacho C Garrett and J 7 C Andrade P Barros O Guimar aes Radiation induced neurotoxicity clinical and radiological improvement after hyperbaric oxygen therapy Neurological Sciences vol 36 no 6 pp 1057 1059 2015 8 M H Bennett J Feldmeier N Hampson R Smee and C Milross Hyperbaric oxygen therapy for late radiation tissue injury Cochrane Database of Systematic Reviews vol 3 Article ID CD005005 2012 9 M L Edwards Hyperbaric oxygen therapy Part 2 application in disease Journal of Veterinary Emergency and Critical Care vol 20 no 3 pp 289 297 2010 10 P Buzzacott P Denoble R Dunford and R Vann Dive problems and risk factors for diving morbidity Diving and Hyperbaric Medicine vol 39 no 4 pp 205 209 2009 11 R Olsza nski P Radziwon J Korsak P Siermontowski and M Kozakiewicz Evaluation of the risk of decompression sickness in saturated nitrox diving by examination ofhaemostasis Polish Hyperbaric Research vol 46 no 1 4 pp 27 30 1995 12 A A Bove The cardiovascular system and diving risk Undersea Hyperbaric Medicine vol 38 no 4 pp 261 269 2011 13 A Perovic A Unic and J Dumic Recreational scuba diving Negative or positive effects of oxidative and cardiovascular stress Biochemia Medica vol 24 no 2 pp 235 247 2014 14 C Marabotti A Scalzini D Menicucci M Passera R Bedini and A L Abbate Cardiovascular changes during SCUBA diving An underwater Doppler echocardiographic study Acta Physiologica vol 209 no 1 pp 62 68 2013 15 D Glavas D Bakovic A Obad et al Effects of tetrahydrobiopterin on venous bubble grade and acute diving induced changes in cardiovascular function Clinical Physiology and Functional Imaging vol 29 no 2 pp 100 107 2009 16 S Hayek and M Nemer Cardiac natriuretic peptides from basic discovery to clinical practice Cardiovascular Therapeutics vol 29 no 6 pp 362 376 2011 17 P De Vito Atrial natriuretic peptide An old hormone or a new cytokine Peptides vol 58 pp 108 116 2014 18 S Rubattu S Sciarretta and M Volpe Atrial natriuretic peptide gene variants and circulating levels implications in cardiovascular diseases Clinical Science vol 127 no 1 pp 1 13 2014 19 W Song H Wang and Q Wu Atrial natriuretic peptide in cardiovascular biology and disease NPPA Gene vol 569 no 1 pp 1 6 2015 7 20 A Tzanidis R D Hannan W G Thomas et al Direct actions of Urotensin II on the heart Implications for cardiac fibrosis and hypertrophy Circulation Research vol 93 no 3 pp 246 253 2003 21 S Gambaryan and D Tsikas A review and discussion of platelet nitric oxide and nitric oxide synthase do blood platelets produce nitric oxide from l arginine or nitrite Amino Acids vol 47 no 9 article no 1986 pp 1779 1793 2015 22 D Tsikas A critical review and discussion of analytical methods in the l arginine nitric oxide area of basic and clinical research Analytical Biochemistry vol 379 no 2 pp 139 163 2008 23 L Stothers I Laher and G T Christ A review of the L arginine nitric oxide guanylate cyclase pathway as a mediator of lower urinary tract physiology and symptoms The Canadian Journal of Urology vol 10 no 5 pp 1971 1980 2003 24 A C R Mendes A J Ferreira S V B Pinheiro and R A S Santos Chronic infusion of angiotensin 1 7 reduces heart angiotensin II levels in rats Regulatory Peptides vol 125 no 1 3 pp 29 34 2005 25 M Iwata R T Cowling D Gurantz et al Angiotensin 17 binds to specific receptors on cardiac fibroblasts to initiate antifibrotic and antitrophic effects American Journal of Physiology Heart and Circulatory Physiology vol 289 no 6 pp H2356 H2363 2005 26 W O Sampaio R A S dos Santos R Faria Silva L T Da Mata Machado E L Schiffrin and R M Touyz Angiotensin 1 7 through receptor Mas mediates endothelial nitric oxide synthase activation via Akt dependent pathways Hypertension vol 49 no 1 pp 185 192 2007 27 W O Sampaio C H De Castro R A S Santos E L Schiffrin and R M Touyz Angiotensin 1 7 counterregulates angiotensin II signaling in human endothelial cells Hypertension vol 50 no 6 pp 1093 1098 2007 28 D Albrecht Angiotensin 1 7 induced plasticity changes in the lateral amygdala are mediated by COX 2 and NO Learning Memory vol 14 no 3 pp 177 184 2007 29 J Fortin T K Ch Wagner H Sterner Ch Madritsch and R Gr ullenberger The Task Force Monitor A Non invasive Beatto beat Monitor for Hemodynamic and Autonomic Function of the Human Body in Proceedings of the 20th annual International Conference of the IEEE Engineering in Medicine and Biology Society 1998 30 J Fortin and W M R Grullenberger Continuous non invasive blood pressure monitoring using concetrically interlocking control loops Computers in Biology and Medicine pp 941 57 2006 31 G Parati A Frattola M Di Rienzo A Zanchetti and G Mancia Dynamic Evaluation of The Baroreflex in Ambulant Subjects IOS Press 1992 32 N Fagoni A Sivieri G Antonutto et al Cardiovascular responses to dry resting apnoeas in elite divers while breathing pure oxygen Respiratory Physiology Neurobiology vol 219 pp 1 8 2015 33 R Pougnet L Pougnet B Lodd e et al Cardiovascular risk factors and cardiovascular risk assessment in professional divers International Maritime Health vol 63 no 3 pp 164 169 2012 34 F Tocco A Crisafulli F Melis et al Cardiovascular adjustments in breath hold diving Comparison between divers and non divers in simulated dynamic apnoea European Journal of Applied Physiology vol 112 no 2 pp 543 554 2012

Page 87

8 35 E Gempp J E Blatteau P Louge I Drouillard and F M Galland N Terminal pro brain natriuretic peptide increases after 1 h scuba dives at 10 m depth Aviation Space and Environmental Medicine vol 76 no 2 pp 114 116 2005 36 J Marinovic et al Assessment of extravascular lung water and cardiac function intrimix SCUBA diving Medicine and Science in Sports and Exercise vol 42 no 6 pp 1054 1061 2010 37 C Passino E Franzino A Giannoni et al B type natriuretic peptide secretion following scuba diving Biomarkers in Medicine vol 5 no 2 pp 205 209 2011 38 M Arborelius et al Hemodynamic changes in man during immersion with the head above water Aerospace Medicine vol 43 no 6 pp 592 598 1972 39 S K Hong P Cerretelli J C Cruz and H Rahn Mechanics of respiration during submersion in water Journal of Applied Physiology vol 27 no 4 pp 535 538 1969 40 B A Davis Diving Medicine 4th edition 2004 41 S R Thom Oxidative stress is fundamental to hyperbaric oxygen therapy Journal of Applied Physiology vol 106 no 3 pp 988 995 2009 42 A Sureda J M Batle X Cap o et al Scuba diving induces nitric oxide synthesis and the expression of inflammatory and regulatory genes of the immune response in neutrophils Physiological Genomics vol 46 no 17 pp 647 654 2014 43 D M J Milstein R Helmers S Hackmann C N W Belterman R A van Hulst and J de Lange Sublingual microvascular perfusion is altered during normobaric and hyperbaric hyperoxia Microvascular Research vol 105 pp 93 102 2016 44 A K Laflamme L Oster R Cardinal and J De Champlain Role of NO and angiotensin II in the early development of endothelial functions impairment and cardiac hypertrophy in deoxycorticosterone acetate Salt hypertension Canadian Journal of Physiology and Pharmacology vol 76 no 6 pp 665 675 1998 45 Q Wang A Mazur X F Guerrero et al Antioxidants endothelial dysfunction and DCS In vitro and in vivo study Journal of Applied Physiology vol 119 no 12 pp 1355 1362 2015 46 V K Somers M E Dyken A L Mark and F M Abboud Sympathetic nerve activity during sleep in normal subjects The New England Journal of Medicine vol 328 no 5 pp 303 307 1993 47 G Mancia Autonomic modulation of the cardiovascular system during sleep The New England Journal of Medicine vol 328 no 5 pp 347 349 1993 48 S K Hong Mechanics of respiration during submersion in water SAM TR 70 5 1970 Tech Rep SAM TR 49 S B Ardestani P Buzzacott and I Eftedal The aging diver Endothelial biochemistry and its potential implications for cardiovascular health Diving and Hyperbaric Medicine vol 45 no 4 pp 235 239 2015 50 P D Thompson The cardiovascular risks of diving Undersea Hyperbaric Medicine vol 38 no 4 pp 271 277 2011 51 P J Denoble Scuba injury death rate among insured DAN members Diving Hyperbaric Medicine vol 38 no 4 pp 182 188 2008 Evidence Based Complementary and Alternative Medicine

Page 88

Hyperbaric oxygenation Alterations in cardiac output and regional blood flow Paul B Hahnloser M D Erwin Domanig M D Edward Lamphier M D and Worthington G Schenk Jr M D Buffalo N Y Xxyperbaric oxygenation has been empirically evaluated in a variety of hypoxic states of surgical importance Little information however is currently available to indicate what changes if any occur in cardiac output or regional blood flow in response to hyperbaric oxygenation We have investigated these hemodynamic responses to hyperbaric oxygenation as a necessary preliminary to a rational choice of abnormal states which might be benefitted by such treatment Methods All hyperbaric oxygenation studies were performed in a standard U S Navy decompression chamber which was extensively instrumented All flow recordings were performed by means of a squarewave electromagnetic flowmeterj and direct writing polygraph located outside the chamber This From the Departments of Surgery and Physiology State University of New York at Buffalo and the Edward J Meyer Memorial Hospital Buffalo N Y Supported in part by grants in aid from the National Heart Institute HE 03181 of the U S Public Health Service and the Erie County Heart Association Received for publication Feb 23 1966 Research Fellow of the United Health Foundation of Western New York fSupplied by the Office of Naval Research under Contract No 969 03 Carolina Medical Electronics Winston Salem N C flowmeter was connected to a probe switchbox located inside the chamber and permitted flow recordings from four areas in rapid sequence Flow zero was determined by intermittent occlusion of each vessel studied with the exception of the ascending aorta where the diastolic quiet interval was used as an approximate zero Arterial or left ventricular pressure recordings were made from a resistance strain gauge transducer located within the chamber and attached to a carrier amplifier and recorder located outside the chamber A polarographic oxygen electrode with associated water bath tonometer and gases for calibration were located within the chamber A surgeon was present within the chamber at all times to ensure the animal s comfort and to carry out required manipulations and measurements Control values were obtained for 20 to 40 minutes while the animal was in the chamber breathing room air at atmospheric pressure approximately 740 mm Hg The pressure then raised rapidly to 4 atmospheres absolute pressure after which the animal was given 100 per cent oxygen This gas was provided either from a plastic head box assembly when respiration was spontaneous or from a Harvard respiratory Instrumentation Associates Cambridge Mass 223

Page 89

Journal of 224 Hahnloser et al Thoracic and Cardiovascular Surgery Table I Experimental groups Group 1 II No of experiments Weight Kg Type of preparation Determinations made Range Mean Unanesthetized closed thorax Cardiac output 1 vent pressure 12 5 16 4 14 6 Cardiac output 1 vent pressure left renal artery flow infrarenal aortic flow 7 8 17 7 12 9 Anesthetized closed thorax spontaneous respiration flank incision III Anesthetized open thorax pis Aortic arch branch and deston respirator cending aorta flow aortic arch pressure 10 9 19 1 16 0 IV Anesthetized closed thorax spontaneous respiration open abdomen Cardiac output aortic arch pressure hepatic artery and portal vein flows 10 9 19 5 14 8 Anesthetized closed thorax spontaneous respiration open abdomen No hyperbaric oxygenation Cardiac output aortic arch pressure hepatic artery and portal vein flows 11 3 22 2 17 6 pump when artificial ventilation was necessary because the thorax was open Forty five animals were studied in 5 groups of 9 each as listed in Table I The experimental preparations were made in the following ways Group I Twenty four hours prior to the experiment an electromagnetic flow probe was placed on the ascending aorta and a left ventricular catheter was introduced through the left atrium after which the thorax was closed On the day of the experiment these animals were ambulatory and connection to the pressure and flow measurement equipment was made without anesthesia Each animal was supported in a body sling for the entire experimental interval Group II On the day of experiment a probe was placed on the ascending aorta and the chest was closed Through a retroperitoneal left flank incision flow probes were placed on the left renal artery and the abdominal aorta distal to the renal arteries An inlying catheter was placed in the left ventricle for pressure recording Anesthesia with minimal quantities of chloralose was maintained throughout the experiment Group III Flow probes were placed on the brachiocephalic and left subclavian arteries as well as the descending aorta just distal to the subclavian artery Arterial pressure was recorded via an inlying femoral catheter The thorax remained open throughout the study with ventilation being performed by a Harvard piston respirator via an endotracheal tube Intravenous chloralose anesthesia was maintained as described above Group IV A flow probe was placed on the ascending aorta and the chest was closed Spontaneous respirations resumed Through a midline abdominal incision probes were placed on the hepatic artery and portal vein Aortic arch pressure was recorded via an inlying catheter Again anesthesia with chloralose was maintained throughout the experiment Group V The preparation was identical to that in Group IV except that no hyperbaric oxygenation was carried out A complete set of pressure and flow measurements was made every 15 minutes for the 90 or 120 minutes of hyperbaric oxygenation Samples for the measurement of p 0 2 were taken from the 5 groups at ran

Page 90

Volume 52 Hyperbaric oxygenation Number 2 225 August 1966 Table II p02 after 90 minutes of hyperbaric oxygenation at 4 ATA mm Hg Arterial Central venous blood blood 235 185 250 90 95 1 420 90 2 890 2 660 2 370 2 300 2 840 2 710 2 490 Average 2 608 i 227 S D 336 Table III Theoretical and actual blood oxygen values and A V differences o pO mm Hg Optimal calculated intra alveolar value 2 933 Oxygen measured in arterial blood 2 608 Oxygen measured in central venous blood Differ vol per cent ence in vol per cent 8 8 1 0 7 8 6 8 336 l O dom from arterial and central venous blood after 90 minutes of hyperbaric oxygenation Results The p 0 2 measurements are shown in Table II and indicate a mean of 2 608 mm Hg in arterial blood and a mean of 336 in central venous blood During oxygen breathing at 4 ATA the total pressure can be calculated as 740 mm Hg average barometric pressure in Buffalo quadrupled equalling 2 960 mm Hg If one subtracts 47 mm Hg for water vapor at 37 C and assumes an average alveolar pC0 2 for the anesthetized dog of 40 mm Hg then the calculated optimal alveolar pO a is 2 960 47 40 2 873 mm Hg The amount of physically dissolved oxygen in the blood at 37 C is 0 0031 vol per cent per millimeters of mercury of p 0 2 with a normal solubility coefficient assumed Calculated optimal blood oxygen values and the actual measured values are compared in Table III At normal pH we find a p 0 2 of 90 mm Hg as the minimal value measured in central venous blood which indicates that the hemoglobin is still fully saturated with oxygen Oxygen extraction from the arterial blood during its passage through the greater circulation was all from that part dissolved physically and no reduction of oxyhemoglobin occurred Hematocrits measured before during and after hyperbaric oxygenation varied from 43 to 58 per cent with no systematic alterations No convulsions were seen during hyperbaric oxygenation but some dogs became restless in the unanesthetized group Group I Unanesthetized The cardiac output and left ventricular pressure alterations in this group are shown in Fig 1 Cardiac output dropped to 20 per cent below the control level in the first 30 minutes and then continued to fall slowly to the end of the 120 minute period Simultaneously the left ventricular pressure dropped only 5 to 7 per cent below control values Both values approached control levels after decompression Alteration in heart rate and respiratory rate in this group is shown in Fig 2 Heart rate declined 10 to 12 per cent and in 6 of the 9 experiments gross arrhythmias appeared One example of such arrhythmia is shown in Fig 3 We do not believe that any particular significance can be ascribed to the respiratory rate changes since they seemed related to erratic periods of restlessness No convulsions or neurological sequelae resulted and all animals survived several days until sacrifice Group II Cardiac output renal flow distal abdominal aorta flow As seen in Fig 4 cardiac output in this group dropped steadily to 22 per cent below control Left renal flow fell to an even greater extent than cardiac output reaching a value 35 per cent below control level at 90 minutes

Page 91

Journal of 2 2 6 Hahnloser et al Thoracic and Cardiovascular Surgery HYPERBARIC OXYGEN AT 4ATA s o BE H Ul a _i z o o _ SL00D PRESSURE I t 10O z H li CdROIAC OUTPUT 30o 8 20H rr UJ 20 30 r 90 60 MINUTES 1 120 r 150 Fig 1 Cardiac output and left ventricular pressure changes in unanesthetized dogs 30 60 90 MINUTES Fig 2 Heart and respiratory unanesthetized dogs rate changes in The abdominal aorta distal to the renal arteries yielded more variable values but always showed flow decrease proportionately greater than the reduction in cardiac output All values rose rapidly toward control levels on decompression and resumption of air breathing Group III Cardiac output Aortic arch flow studies Cardiac output was calculated by summation of the three flows that is the left subclavian artery the brachiocephalic artery and the descending aorta The sum of the brachiocephalic and left subclavian flows was recorded as aortic arch outflow These results are plotted in Fig 5 It will be noted that aortic arch outflow fell less 12 per cent maximum fall than cardiac output 30 per cent maximum that is there was a preferential flow shift toward the aortic arch area while the descending aorta flow decreased more than the cardiac output Group IV Cardiac output Hepatic blood flow These results are seen in Fig 6 and show that portal vein flow fell in almost direct proportion to reduction in cardiac output while hepatic artery flow was reduced proportionately less Group V Controls These results are seen in Fig 7 Approximately 90 minutes BREATHING AIR AT I ATA mmHg AORTIC 150ARCH 100PRESSURE BREATHING 0 2 AT4ATA FOR 105 MIN 150100 iv NN V iV Sf NV f 0 AORTIC ARCH FLOW 1 1 1230 0 IUW IJU I i 5 10 SECONDS A O R T I C ARCH PRESSURE l 2 2 m m H g HEART RATE 129 Min RESPIRATORY RATE 24 Min cc mia i 0 Ui UUiiV I 5 10 SECONDS 130 mm Hg 122 M i n 2 8 DECREASE IN CAROIAC OUTPUT Fig 3 Aortic arch pressure and ascending aorta flow Note marked arrhythmia evident after 105 minutes of hyperbaric oxygenation

Page 92

Page 93

Journal of 228 Hahnloser et al Thoracic and Cardiovascular Surgery UNANESTHETIZED INCREASE OF TOTAL PERIPHERAL RESISTANCE AT 90 MINUTES n i8 ANESTHETIZED CLOSED CHEST SPONTANEOUS BREATHING FLANK INCISION HO 20 1 LU 20 A 67 ANESTHETIZED OPEN CHEST PISTON RESPIRATOR A 66 ANESTHETIZED CLOSED CHEST SPONTANEOUS BREATHING OPEN ABDOMEN A 40 co _ ANESTHETIZED CLOSED CHEST SPONTANEOUS BREATHING OPEN ABDOMEN i 0 1 1 r r Mi A 2 HYPERBARIC OXYGENATION 30 60 90 120 150 HO HYPERBARIC OXYGEN AT 4ATA BP BLOO0 PRESSURE CO CARDIAC OUTPUT Fig 8 Comparison of cardiac output blood pressure and total peripheral resistance values in all 5 experimental groups whereas Bernhard 2 found the cardiac output not appreciably affected in anesthetized infants just prior to open heart surgery for a variety of cardiac diseases In contrast Illingworth7 describes in 1 case of low cardiac output due to barbiturate poisoning a rise in cardiac output from 3 to 8 L per minute during hyperbaric oxygenation at 2 ATA however stimulants were used at the same time It is interesting to note that we found a consistent rise in arterial pressure in the anesthetized animal with closed abdomen which was breathing spontaneously or was being ventilated artificially The total body peripheral resistance in these two groups showed therefore the most significant rise External power of the left ventricle if calculated as the product of cardiac output and mean aortic arch pressure was only slightly reduced in these two groups Hyperbaric oxygenation therefore would not seem to be of great benefit for a failing heart under anesthesia if the problem was primarily low cardiac output and not undersaturation of the arterial blood However in the unanesthetized group a certain reduction in the left ventricular power occurred as both cardiac output and blood pressure were reduced Increased irritability of the heart is a common finding during hyperbaric oxygenation We observed severe respiratory arrhythmias mainly in the unanesthetized dogs after 60 minutes of exposure Similarly Just Viera0 reported an increase in incidence

Page 94

Volume 52 Hyperbaric oxygenation Number 2 229 August 1966 CONTROL VALUES HYPERBARIC OXYGENATION A T 4 A T A FOR 9 0 M I N U T E S 25 cc Kg min CHANGE FROM CONTROL Fig 9 Graphic representation of relative flow changes in the various areas studied It must be kept in mind that these columns represent information derived from 5 different sets of experiments of ventricular fibrillation in experimental massive pulmonary embolism treated with hyperbaric oxygenation In experimental myocardial infarction on the other hand Kuhn10 and Chardack 4 observed a reduced incidence of ventricular fibrillation during hyperbaric oxygenation but the over all mortality rate following coronary ligation was not significantly decreased in a large number of experiments Chardack The average oxygen tension in arterial blood was found to be 325 mm Hg smaller than the optimal value calculated This corresponds to a difference in oxygen content of 1 vol per cent This loss of oxygen represents intrapulmonary arteriovenous shunting and is most likely due to atelectasis during breathing of 100 per cent oxygen Rahn 13 Rennie14 found an alveolo arterial oxygen difference of 220 mm Hg in anesthetized dogs breathing pure oxygen at normal atmospheric pressure An increase of the ambient pressure to 2 5 ATA showed no significant rise in this shunting during 30 minutes The average arteriovenous oxygen dif ference in our experiment was 6 8 vol per cent With the assumption of a normal A V oxygen difference of 5 to 5 5 vol per cent in the anesthetized dog a rise in oxygen extraction from arterial blood of 24 to 36 per cent is represented This is compatible with the decrease of 25 per cent in cardiac output seen in our experimental groups and indicates that oxygen uptake during respiration with 100 per cent oxygen was unchanged This has been established to be the case with oxygen breathed at atmospheric pressure12 as well as under hyperbaric conditions 15 Blood flows to both the kidney and to the liver the latter representing splanchnic flow showed more reduction than the average cardiac output itself This is also reflected in the higher decrease in the flow of the descending aorta These studies confirm the work of Rennie and Knox15 which demonstrated a 57 per cent reduction in renal blood flow as measured by the Diodrast clearance method in dogs breathing 100 per cent oxygen at 4 ATA They likewise demonstrated increased peripheral resistance Blood flow through the lower abdominal aorta reflecting flow to the hind limbs showed a very high reduction Bird 3 using the plethysmographic technique on the forearm of conscious men found a flow reduction of 19 per cent during hyperbaric oxygenation at 2 ATA simultaneously with a slight rise in arterial blood pressure This obvious increase of peripheral resistance might account for the inconsistent therapeutic results when hyperbaric oxygenation is used in cases of gas gangrene of limbs with intact vessels Brown I cited by Maloney 11 Aortic arch outflow which consists mainly of blood flow to the brain other parts of the head neck and upper extremities showed the slightest reduction in our studies If we assume a flow reduction in the upper extremities similar to that observed in the hind limbs we might conclude that blood flow to the brain was little changed by hyperbaric oxygenation Similar findings were

Page 95

Journal of 230 Hahnloser et al Thoracic and Cardiovascular Surgery reported by Bean 1 who found no significant alterations in carotid artery flow in urethanized dogs breathing pure oxygen at 5 ATA for 30 to 90 minutes Jacobson 8 using the clearance method to measure carotid artery flow in anesthetized dogs observed a reduction of 21 per cent in flow during oxygen breathing at 2 ATA Lambertson cited by Jacobson 8 showed a reduction in cerebral blood flow of 24 per cent during hyperbaric oxygenation at 3 5 ATA This sustained high blood flow to the brain might account for the high incidence of cerebral disturbances observed after longer exposures to hyperbaric oxygenation Hitchcock 11 and Lambertson cited by Maloney 11 The changes here reported in cardiovascular dynamics during hyperbaric oxygenation have all been previously reported during the breathing of pure oxygen at atmospheric pressure Eggers Murray 1 Rennie14 and were qualitatively the same but of higher magnitude Summary Cardiac output left subclavian artery brachiocephalic artery descending aorta renal artery portal vein and hind limb area blood flows were measured in 45 dogs Arterial pressure and arterial and venous p 0 2 were recorded Hyperbaric oxygenation 100 per cent oxygen at 4 ATA for 90 to 120 minutes resulted in the following findings 1 Arterial pOL reached a mean value of 2 608 mm Hg intrapulmonary blood shunting prevented the optimum value of 2 873 mm Hg from being achieved 2 Cardiac output was reduced 20 to 25 per cent in both anesthetized and conscious animals with a concomitant 24 to 36 per cent rise in arteriovenous oxygen difference total body oxygen consumption was unchanged 3 Cardiac rhythm became very irregular after 1 hour of hyperbaric oxygenation 4 Consistent rise in total peripheral resistance was seen in all animals particularly those under anesthesia 5 Renal artery flow fell to a greater degree than cardiac output 6 Hepatic artery flow fell to a lesser degree than did cardiac output Portal vein flow fell in direct proportion to cardiac output decrease 7 Hind limb somatic area flow was decreased proportionately more than cardiac output 8 Aortic arch distribution flow was reduced significantly less than cardiac output fell which suggested only a slight reduction in cerebral blood flow The authors wish to express their thanks to Mr Richard Morin and Dr Hermann Rahn for technical assistance and advice in the performance of these studies REFERENCES 1 Bean J W Effects of Oxygen at Increased Pressure Physiol Rev 25 1 147 1945 2 Bernhard W F Somers L A Kriek H Abe T Cunanan O and McDonald S Pulmonary Compliance and Pulmonary Vascular Resistance Under Hyperbaric Conditions S Forum 50 197 198 1964 3 Bird A D and Tefler A B M Effect of Hyperbaric Oxygen on Limb Circulation Lancet 1 355 356 1965 4 Chardack W M Gage A A Federico A J Cusik J K Matsumoto P J H and Lanphier E H Reduction by Hyperbaric Oxygenation of the Mortality From Ventricular Fibrillation Following Coronary Artery Ligation Circulation Res 15 497502 1964 5 Eggers G W N Jr Paley H W Leonard J J and Warren L V Hemodynamic Responses to Oxygen Breathing in Man J Appl Physiol 17 75 79 1962 6 Hitchcock C R Harris R H and Haglin J J Hyperbaric Oxygenation in Cardiac and Pulmonary Disease Dis Chest 44 622 632 1963 7 Illingworth C F W Smith G Lawson D D Leddingham I Sharp G R Griffiths J C and Henderson C I Surgical and Physiological Observations in an Experimental Pressure Chamber Brit J Surg 49 222 1961 8 Jacobson I Harper A M and McDowall D G The Effects of Oxygen Under Pressure on Cerebral Blood Flow and Cerebral Venous Oxygen Tension Lancet 2 549 1963 9 Just Viera J O and Yeager G H Massive Pulmonary Embolism IV The Value of

Page 96

Page 97

Page 98

Page 99

Page 100

Page 101

Page 102

Page 103

Page 104

NEURAL REGENERATION RESEARCH February 2017 Volume 12 Issue 2 www nrronline org REVIEW Hyperbaric oxygen preconditioning improves postoperative cognitive dysfunction by reducing oxidant stress and inflammation Zhi xin Gao Jin Rao Yuan hai Li Department of Anesthesiology First Affiliated Hospital of Anhui Medical University Hefei Anhui Province China How to cite this article Gao ZX Rao J Li YH 2017 Hyperbaric oxygen preconditioning improves postoperative cognitive dysfunction by reducing oxidant stress and inflammation Neural Regen Res 12 2 329 336 Open access statement This is an open access article distributed under the terms of the Creative Commons Attribution NonCommercialShareAlike 3 0 License which allows others to remix tweak and build upon the work non commercially as long as the author is credited and the new creations are licensed under the identical terms Funding This study was supported by the Special Research Foundation of Doctoral Course in Colleges and Universities of China in 2013 No 20133420110009 Abstract Correspondence to Postoperative cognitive dysfunction is a crucial public health issue that has been increasingly studied in efforts to reduce symptoms or prevent its occurrence However effective advances remain lacking Hyperbaric oxygen preconditioning has proved to protect vital organs such as the heart liver and brain Recently it has been introduced and widely studied in the prevention of postoperative cognitive dysfunction with promising results However the neuroprotective mechanisms underlying this phenomenon remain controversial This review summarizes and highlights the definition and application of hyperbaric oxygen preconditioning the perniciousness and pathogenetic mechanism underlying postoperative cognitive dysfunction and the effects that hyperbaric oxygen preconditioning has on postoperative cognitive dysfunction Finally we conclude that hyperbaric oxygen preconditioning is an effective and feasible method to prevent alleviate and improve postoperative cognitive dysfunction and that its mechanism of action is very complex involving the stimulation of endogenous antioxidant and anti inflammation defense systems Yuan hai Li M D Ph D liyuanhai 1 163 com orcid 0000 0001 6763 9624 Yuan hai Li doi 10 4103 1673 5374 200816 Accepted 2016 12 22 Key Words nerve regeneration brain injury hyperbaric oxygenation preconditioning antioxidants antiinflammation reactive oxygen species oxidant stress inflammation protection post operation cognitive dysfunction neural regeneration Introduction Postoperative cognitive dysfunction POCD is a complication of surgery that is widely considered an important clinical problem particularly in elderly patients Shoair et al 2015 However the pathophysiology underlying POCD is fairly complex involving numerous mechanisms including oxidant stress inflammation and apoptosis Eckenhoff et al 2004 Dong et al 2009 Thom 2009 Cao et al 2012 Wilson et al 2013 Over the past several decades researchers have explored a wide array of methods for improving POCD including hyperbaric oxygen preconditioning HBOPC HBOPC is one of the most economical simple safe and effective strategies among all the possible choices Zhu et al 2016 Indeed studies have successfully utilized HBOPC to improve cognitive dysfunction Alex et al 2005 Peng et al 2010 Sun et al 2014 The purpose of this narrative review is to summarize and discuss the literature concerning HBOPC and POCD with an emphasis on the evidence for a role of HBOPC in treating patients undergoing POCD The review is organized into the following sections introduction of HBOPC mechanisms underlying POCD and the effect of HBOPC on POCD Figure 1 HBOPC Definition of HBOPC During HBO treatment patients usually inhale pure oxygen 100 at pressures greater than the atmospheric pressure in a steel vessel L ndahl 2012 which increases both the dissolved oxygen and the partial pressure of oxygen in blood plasma Tibbles and Edelsberg 1996 Consequently a large amount of oxygen dependent reactions and signaling pathways are enhanced Babchin et al 2011 Application of HBOPC Normobaric oxygen and various levels of HBO have been widely utilized therapeutic agents and Valenzuela pioneered the application of pure oxygen as high as 2 MPa in clinical research Edwards 2010 The use of HBO as an adjuvant treatment for a number of medical conditions has been widely supported by the experience of experts in hyperbaric medicine and the scientific literature in areas such as traumatic brain injury Hu et al 2016 Zhou et al 2016a b complex refractory wounds Morykwas and Argenta 1996 cerebral infarction Tian 2015 and radiation tissue injury Kindwall and Hunt 1995 Kindwall and Wheland 1999 Along with the development of medicines disease prevention has increasingly become recognized as important Pre329

Page 105

Gao et al Neural Regeneration Research 2017 12 2 329 336 HBOPC Application of HBOPC POCD Pathogenetic mechanism of postoperative cognitive dysfunction Activate the antioxidant enzyme and decrease the pro oxidant enzyme Antioxidant stress and Activate the negative feedback loop of ROS hyperbaric oxygen preconditioning on postoperation cognitive dysfunction Antioxidant stress Roles of HBOPC on POCD Regulate signaling pathway of ROS MAPK MMP and ROS RNS Activate the antioxidant genes expression Increase the expression of antioxidant genes Figure 1 Summary of article structure POCD Postoperative cognitive dysfunction HBOPC hyperbaric oxygen preconditioning MMP matrix metalloproteinase ROS reactive oxygen species MAPK mitogen activated protein kinase RNS reactive nitrogen species conditioning is a type of primary prevention that activates endogenous protective mechanisms which can reduce the risk of morphologic and functional sequelae The preconditioning state is typically defined by the response to a sublethal stimulus that extends beyond its presence in the system This response significantly lessens the level of signal cascades for stress activated and stress reactive proteins which subsequently shows a protective effect for cells Recently HBO has become recognized as an effective preconditioning method for reducing mental and cellular stresses especially in regimented sessions of moderate HBO Nie et al 2006 Li et al 2008 In the clinic however HBOPC has had only minimal impact before surgery and no role in the surgery or post surgical care of patients Allen et al 2014 HBO protocols are performed at 2 0 2 5 atmosphere absolute ATA oxygen partial pressures and usually only applied for one or a few days The physical adaptations in response to alterations in atmospheric oxygen appear to extend not only to survival but also a preconditioned state Similar to ischemic and stress preconditioning many different paradigms have been used to demonstrate that either rapid or delayed tolerance is affected by the HBO Stetler et al 2014 To achieve the best outcome using HBOPC it requires a certain O2 concentration and high pressure When air 20 oxygen rather than 100 O2 was infused into the hyperbaric chamber the tolerance was negated demonstrating the need for high O2 concentration in the hyperbaric preconditioned state Wada et al 2001 Additionally Kocao ullar et al 2004 compared normobaric oxygen with HBO treatment of rats with cerebral vasospasm after subarachnoid hemorrhage and found that normobaric oxygen was less effective in ameliorating neurological deficits associated with the central nervous system Many experiments have shown that HBOPC can protect against subsequent multi organ injury to the brain heart or liver Alex et al 2005 Yu et al 2005 330 Qin et al 2008 Previous studies suggest that preconditioning with pressures of 2 ATA 3 5 sessions every other day was effective in inducing tolerance against global ischemia in gerbils Wad et al 1996 Wada et al 2001 Cheng et al 2011 reported that 2 5 ATA preconditioning 1 hour daily for 5 days protected against subsequent global ischemic injury in rats Cheng et al 2011 Similarly pretreatment with HBO has been found both to improve the degree and accelerate the rate of neurologic recovery Additionally long term HBOPC paradigms have been shown to be more effective at establishing tolerance than are acute paradigms Xiong et al 2000 Dong et al 2002 Nie et al 2006 Liu et al 2012 Animal studies of ischemia reperfusion I R injury in the myocardium have indicated that HBO preconditioning can lead to ischemia tolerance resulting in protection against myocardial ischemia Kim et al 2001 In addition to these experimental studies clinical studies have demonstrated that preconditioning patients who have coronary artery disease with HBO before on pump cardiopulmonary bypass or coronary artery graft bypass were in a position improved myocardial function and reduced myocardial injury the duration of staying in the intensive care unit blood loss postoperative complications and cost Yogaratnam et al 2010 Li et al 2011 Karu et al 2010 indicated that exposure to hyperoxia for a limited time before ischemia induced a mild oxidative stress and resulted in an ischemic preconditioning like effect in the myocardium which protected the heart from subsequent injury Yu et al 2005 performed an experimental study in rats and reported preconditioning with single dose HBO 90 minutes protects the rat liver against subsequent I R injury Ren et al 2008 similarly reported that HBO preconditioning increased the number of new cells and the density of microcirculation in the regenerating liver Therefore HBO preconditioning is an encouraging and feasible therapeutic strategy for protecting organs from the subsequent lethal stimulus The effect and

Page 106

Gao et al Neural Regeneration Research 2017 12 2 329 336 mechanism of HBOPC on POCD will be described below POCD Definition and perniciousness of POCD Every year numerous people undergo surgery hoping that the operation will lighten symptoms heal diseases and improve quality of life Berger et al 2015 Although there is much interest in and controversy about the mechanism and treatment of POCD there is little doubt that cognitive decline after surgery especially in the elderly population is a critical clinical issue that shows a high morbidity POCD is defined as an impairment in mental processes of perception memory and information processing that occurs in the postoperative period Hanning 2005 and which is diagnosed by specific tests after exclusion of other neurological complications Both cardiac surgery and non cardiac surgery are associated with the cognitive dysfunction after hospital discharge from 30 to 50 of patients Newman et al 2001 McDonagh et al 2010 Selnes et al 2012 One study reported the incidence of cognitive decline to be 53 at discharge 36 at 6 weeks after discharge 24 at 6 months after discharge and 42 at 5 years after coronary artery bypass grafting Newman et al 2001 Shoair et al 2015 showed that 15 9 of older adult patients developed POCD within 3 months after elective major non cardiac surgery Other studies have found that POCD is associated with poor shortterm and long term outcomes including an increased risk of disability increased expenditure on hospitalization inability to cope independently reduced quality of life and possible permanent dementia Hovens et al 2014 Shoair et al 2015 Patients with POCD are at an increased risk of death in the first year after surgery and the elderly aged 60 years or older are at a significant risk for long term cognitive problems Moller et al 1998 Monk et al 2008 Avidan et al 2009 Steinmetz et al 2009 Pathogenic mechanism of POCD There is strong standpoint that cognitive decline experienced by elderly patients is directly mediated by neuro inflammation and the enhancement of amyloid beta oligomerization after surgery and general anesthesia Bedford 1955 Eckenhoff et al 2004 M ller et al 2004 Newman et al 2007 Dong et al 2009 Cao et al 2012 At the same time some results suggest that surgery results in neuro inflammation and cognitive impairment and that anesthesia might not be an essential influential factor for these effects Zhang et al 2015 Zhou et al 2015 Despite these controversies existing evidence has confirmed that neuro inflammatory response to operative stress is an independent risk factor associated with the development of POCD Wan et al 2007 Barrientos et al 2012 Hovens et al 2014 Lu et al 2015 Ma et al 2015 Zheng et al 2015 Amyloid beta the peptide associated with Alzheimer s disease was also detected in the serum of POCD patients Another important player is acetylcholine which has significant roles in memory learning and attention Hshieh et al 2008 The most likely mechanism underlying POCD is a central cholinergic deficiency caused by the deregulation of cholinergic anti inflammatory pathways which results in increased inflammation Inouye 2006 Androsova et al 2015 Many scholars have highlighted the importance of the cholinergic reflex in resolving the inflammatory pathogenesis of several diseases including sepsis Borovikova et al 2000 rheumatoid arthritis van Maanen et al 2009 and colitis Ghia et al 2007 Researchers have reported that pro inflammatory cytokines including interleukin IL 1 and tumor necrosis factor alpha TNF play key roles in mediating surgery induced neuro inflammation and subsequent cognitive decline Cibelli et al 2010 Terrando et al 2010 Results reveal that surgery not propofol based anesthesia induces neuro inflammation and the impairment of learning and memory Pyrrolidine dithiocarbamate attenuates these effects by inhibiting nuclear factor kappa B activation and downstream matrix metallopeptidase 9 activity Zhao et al 2013 Zhang et al 2014 Other studies have demonstrated that peripheral surgery affects the blood brain barrier through the release of TNF This promotes macrophage migrating into the hippocampus Rudolph et al 2008 Terrando et al 2011 Vacas et al 2013 Activation of 7 nicotinic acetylcholine receptors trigger an endogenous inflammation resolving pathway that has been proven to be useful in blocking TNF induced nuclear factor kappa B activation and cognitive decline after surgery Terrando et al 2011 Jiang et al 2015 suggested that IL 6 has a crucial role in POCD and that IL 6R antagonists may serve as novel agents for its prevention or treatment Chen et al 2015 also demonstrated that dexmedetomidine reduces the incidence of POCD by suppressing inflammation in aged patients Roles of HBOPC on POCD Cognitive decline after surgery includes deterioration in cognition disturbance in attention and reduced awareness of the environment In light of recent clinical developments HBO preconditioning has been shown to protect against focal and global cerebral ischemia as well as traumatic brain injury Cheng et al 2011 Yan et al 2011 Lin et al 2012 Furthermore HBO preconditioning can promote both cerebral protective and cardiac protective effects as determined by biochemical markers of neuronal and myocardial injury and clinical consequences in patients experiencing on pump coronary artery bypass graft surgery Yogaratnam et al 2010 Li et al 2011 Additionally Alex et al 2005 indicated that while pretreatment with 2 4 ATA HBO can reduce neuropsychometric dysfunction and modulate the inflammatory response that occurs after cardiopulmonary bypass In basic studies Sun et al 2014 indicated that HBO preconditioning can significantly lessen cognitive impairment and that it can be considered responsible for decreases in pro inflammatory either systemic or central cytokines and caspase 3 activity Similarly Peng et al 2010 indicated that continuous HBOPC could lead to an apparent improvement in impairments of associative learning and spatial memory The study also showed that HBOPC has an effective anxiolytic effect and provided experimental evidence that supports the idea that HBOPC is useful for treating some affective disorders including post traumatic stress disorder All 331

Page 107

Gao et al Neural Regeneration Research 2017 12 2 329 336 these results showed that HBO preconditioning is a safe and feasible procedure that can attenuate cognitive impairments after surgery Additionally they show that it is associated with anti oxidants stress anti inflammation and anti apoptosis as well as increased regional cerebral blood flow distribution and improvement of blood brain barrier integrity Li et al 2007 Micarelli et al 2013 Tian et al 2013 Sun et al 2014 Among these phenomena the anti oxidative stress and anti inflammatory action of HBOPC are considered two crucial mechanisms with respect to easing POCD Antioxidant stress 1 Anti oxidative stress is achieved through activation of antioxidant enzymes and the decrease of pro oxidant enzymes HBO can elevate the partial pressure of oxygen and enhance the cellular tolerance against harmful stimuli by inducing the expression of cell protective proteins Thom 2009 Several studies have shown that the endogenous antioxidant defense system becomes active in parallel with the development of HBOPC induced neuroprotection Nie et al 2006 Thom 2009 Huang et al 2014 Numerous studies have shown that repeated preconditioning with HBO but not normal conditions can protect the spinal cord against I R damage Nie et al 2006 Lu et al 2012 Huang et al 2014 These results have been attributed to the protective effect of upregulated HO 1 and the activity of catalase and superoxide dismutase SOD which are triggered by HBO preconditioning Li et al 2007 Further investigations have shown that when dimethylthiourea a potent free radical scavenger was administered before each session of HBO treatment the HBO induced catalase and SOD activities were abolished Similarly when the catalase inhibitor 3 amino 1 2 4 triazole or dimethylthiourea was administered before spinal cord ischemia the ischemic tolerance induced by HBOPC was attenuated Nie et al 2006 Huang et al 2014 HBOPC was shown to decrease mortality rate improve neurological recovery lessen neuronal injury reduce the level of malondialdehyde and increase antioxidant activity of catalase and SOD Li et al 2008 Repeated HBO exposure supplies protection against oxygen toxicity in the central nervous system and this may be attributed to the decreased enzymatic activity of the antioxidant system and reduced levels of peroxynitrite primarily in the hippocampus Arieli et al 2014 In related work Peng et al 2010 suggested that HBOPC is beneficial for the improvement of anxiety like behavior and cognitive impairments arising from a single prolonged exposure to stress and that this effect might be associated with inhibition of neuronal apoptosis via upregulation of thioredoxin reductase in stressed rats These results confirmed that HBO preconditioning can induce upregulation of antioxidant enzyme activity leading to the generation of tolerance against I R injury in the brain Li et al 2008 Expression of antioxidant enzymes including Cu Zn superoxide dismutase catalase and glutathione peroxidase have been shown to be enhanced by HBOPC Kim et al 2001 Li et al 2008 Additionally levels of pro oxidant enzymes such as inducible nitric oxide synthase and gp91 phox have 332 been shown to significantly decrease after HBOPC Zhang and Gould 2014 However few animal experiments reported that in the hippocampus of preconditioned rats the activities of glutathione reductase and glucose 6 phosphate dehydrogenase were substantially decreased while the activity of glutathione peroxidase was greatly increased Arieli et al 2014 2 Anti oxidative stress is also achieved through the reactive oxygen species negative feedback loop Transiently increased reactive oxygen species ROS levels activate a negative feedback loop which leads to downregulation of oxidant enzymes and upregulation of antioxidant enzymes thereby limiting subsequent higher levels of reactive species of oxygen and nitrogen production Zhang and Gould 2014 Furthermore these results also indicate that ROS related enzymes including inducible nitric oxide synthase and nicotinamide adenine dinucleotide phosphate oxidase rather than the ROS itself can be crucial therapeutic targets for inhibiting oxidative stress 3 Anti oxidative stress can also result from regulation of the ROS mitogen activated protein kinase MAPK matrix metalloproteinase MMP and ROS reactive nitrogen species RNS signaling pathways HBO repairs ischemic wounds by decreasing the phosphorylation of extracellular signal regulated kinases 1 2 c Jun N terminal kinase and c Jun which suggests that mitogen activated protein kinase is downregulated All these results demonstrate that HBO acts via the ROS MAPK MMP signaling pathway to decrease neurodegeneration and ameliorate healing of ischemic wounds Zhang and Gould 2014 For example the level of oxidative stress in ischemic wound tissue will be highly enhanced when the effect of HBO is completely blocked Zhang and Gould 2014 The oxidized N linoleoyl tyrosine marker is sufficiently sensitive to detect oxidative stress imposed on cells and cell free systems and to react selectively with the various ROS RNS that are induced as a result Thus it is very useful for characterizing oxidative stress in general and possibly also in oxidative stress associated diseases Szuchman et al 2006 In one ingenious and delicate experiment the oxidized N linoleoyl tyrosine marker and the protein products of advanced oxidation were analyzed to demonstrate that preconditioning with multiple short HBO exposures followed by a long exposure will lead to a decrease in oxidative adducts reaching even lower levels than that which initially existed in the control group Endogenous antioxidant defense mechanisms induced by HBOPC play an important role in the formation of tolerance against long HBO exposure Palzur et al 2011 4 Antioxidant gene expression is another factor that increases anti oxidative stress Ferrer et al 2007 showed that HBO can also act to activate antioxidant genes in human tissue Endothelial cells are sensitive to high pressure oxygen exposure which easily triggers the expression of many Nrf2 regulated antioxidant genes and molecular chaperones Godman et al 2010a b Additionally the expression of antioxidant genes also occurs in other cells and tissues activated by HBO Padgaonkar et al 1997 Dennog et al 1999 Rothfuss et al

Page 108

Gao et al Neural Regeneration Research 2017 12 2 329 336 2001 Verma et al 2015 All these observations serve to illustrate central role that anti oxidative stress has as a mechanism underlying HBO treatment The findings strongly suggest that HBO preconditioning is a potentially promising treatment for preventing the development of cognitive impairment after surgery Anti inflammation Despite advances in surgical techniques the incidence of neuropsychometric dysfunction after surgery is high Previous studies have demonstrated that the systemic and central inflammatory response plays a critical role in the development of postoperative cognitive impairment Cibelli et al 2010 Fidalgo et al 2011 Barrientos et al 2012 He et al 2012 Hovens et al 2014 Sun et al 2014 and HBO treatment can improve POCD by attenuating inflammatory responses Alex et al 2005 Daniel et al 2011 Lin et al 2012a b 1 Inflammatory responses can be reduced by increased expression of antioxidant genes ROS plays a significant role in transduction cascades and pathways Allen and Balin 1989 Maulik 2002 Ushio Fukai and Alexander 2004 Calabrese et al 2007 HBO related anti inflammatory action can be partially induced through increased expression of antioxidant genes and other cellular defense genes via non cytotoxic oxidative stimuli Godman et al 2010a b Matsunami et al 2010 2011 He et al 2011 Simsek et al 2011 2 Attenuation of inflammatory cells sequestration and adhesion can also reduce inflammatory responses Tissue inflammation can occur when circulating neutrophils adhere to vascular endothelium through interactions with 2 integrins However neutrophil 2 integrin function is inhibited by exposure to HBO Thom et al 2008 Thom 2009 In some cases when animals or humans are exposed to HBO 2 8 3 0 ATA the ability of circulating neutrophils to adhere to target tissues is temporarily inhibited and inflammation is subsequently reduced Thom 1993 Zamboni et al 1993 Thom et al 1997 Labrouche et al 1999 Kalns et al 2002 In ameliorating I R injuries HBO is notably superior to 2 integrin monoclonal antibodies because it does not compromise the immune system Mileski et al 1990 Buras et al 2006 At the same time HBO exposure also leads to the impaired synthesis of cyclic guanosine monophosphate Chen et al 1996 which consequently reduces the activity of the neutrophil specific adhesion molecule CD18 Malik and Lo 1996 In the meantime intercellular adhesion molecule 1 which is a marker of acute and chronic inflammation acts as the receptor of leukocyte function associated antigen 1 CD11a CDx18 This antigen is expressed on various inflammatory cells including neutrophils monocytes and lymphocytes For example some studies have indicated that levels of intercellular adhesion molecule 1 are downregulated by HBO Buras et al 2000 By downregulating the accumulation of these cellular adhesion molecules neutrophil sequestration and adhesion is attenuated which reduced inflammation Zamboni et al 1993 3 Inflammation is also reduced through the inhibition of pro inflammatory cytokine production The production of pro inflammatory cytokines by monocyte macrophages is inhibited after exposure to HBO Pro inflammatory cytokine regulating adhesion molecules and enhancement of heme oxygenase 1 and heat shock proteins e g heat shock protein 70 Rothfuss et al 2001 are all mechanisms considered to play important roles in the anti inflammatory effects of HBO Compared with cells isolated from HBO exposed rats Lahat et al 1995 those isolated from rats that were not previously exposed to HBO released more TNF Additionally in endotoxic rats HBO treatment inhibits the endotoxin lipopolysaccharide induced pro inflammatory cytokines in monocytes and macrophages Benson et al 2003 Niu et al 2007 reported that pyrogenic fever is prevented and suppressed by HBO via decreased overproduction of circulating TNF and hypothalamic prostaglandin E2 Similarly several studies have demonstrated that the rise of TNF Huang et al 2006 and IL 6 Niu et al 2009 induced by lipopolysaccharide administration also can be significantly decreased by HBO pretreatment Further HBO decreases the release of IL 1 and TNF a in monocytes and macrophages derived from human blood Benson et al 2003 HBO exposure is also indicated to lessen cytokine induction Yamashita and Yamashita 2000 Kang et al 2014 Additionally HBO pretreatment inhibits activated inflammation and gliosis and stimulates angiogenesis neurogenesis and production of IL 10 This consequently improves outcomes of traumatic brain injury Lin et al 2012 Pretreatment with HBO is beneficial for recovery after brain surgery and can enhance expression of osteopontin which reduces the expression of IL 1 nuclear factor gene binding and expansive protein kinase B Akt Hu et al 2015 Discussion As presented here there is substantial evidence for a central involvement of oxidant stress and inflammatory response in POCD In addition numerous basic and clinical studies have demonstrated that HBOPC has a protective effect on POCD by reducing the detrimental inflammation and balancing the oxygen free radicals The mechanism underlying preconditioning is not yet fully understood Many researchers have suggested that HBOPC can alleviate cognitive impairment after surgery Sun et al 2014 and subsequently decrease the density of apoptotic cells and further recovery of nerve function Wang et al 2009 Lu et al 2013 The mechanism underlying the protection might involve the reduction of systemic and hippocampal pro inflammatory cytokines Cheng et al 2011 and upregulation of heat shock protein 32 Nie et al 2006 Based on the experimental evidence the prospect for using HBOPC to reduce cognitive impairment after surgery is bright However the number of relevant clinical studies remains low at present Therefore further studies are critical for understanding the fundamental mechanisms of this phenomenon and to explore the optimal parameters for pretreatment Author contributions ZXG prepared the paper JR prepared the reference format YHL presented the idea of the review All authors approved the final version of the paper Conflicts of interest None declared 333

Page 109

Gao et al Neural Regeneration Research 2017 12 2 329 336 Plagiarism check This paper was screened twice using CrossCheck to verify originality before publication Peer review This paper was double blinded and stringently reviewed by international expert reviewers References Alex J Laden G Cale AR Bennett S Flowers K Madden L Gardiner E McCollum PT Griffin SC 2005 Pretreatment with hyperbaric oxygen and its effect on neuropsychometric dysfunction and systemic inflammatory response after cardiopulmonary bypass a prospective randomized double blind trial J Thorac Cardiovasc Surg 130 16231630 Allen M Golembe E Gorenstein S Butler G 2014 Protective effects of hyperbaric oxygen therapy HBO2 in cardiac care A proposal to conduct a study into the effects of hyperbaric pre conditioning in elective coronary artery bypass graft surgery CABG Undersea Hyperb Med 42 107 114 Allen R Balin AK 1989 Oxidative influence on development and differentiation an overview of a free radical theory of development Free Radic Biol Med 6 631 661 Androsova G Krause R Winterer G Schneider R 2015 Biomarkers of postoperative delirium and cognitive dysfunction Front Aging Neurosci 7 112 Arieli Y Kotler D Eynan M Hochman A 2014 Hyperbaric oxygen preconditioning protects rats against CNS oxygen toxicity Respir Physiol Neurobiol 197 29 35 Avidan MS Searleman AC Storandt M Barnett K Vannucci A Saager L Xiong C Grant EA Kaiser D Morris JC 2009 Long term cognitive decline in older subjects was not attributable to non cardiac surgery or major illness Anesthesiology 111 964 Babchin A Levich E Sivashinsky G 2011 Osmotic phenomena in application for hyperbaric oxygen treatment Colloids Surf B Biointerfaces 83 128 132 Barrientos RM Hein AM Frank MG Watkins LR Maier SF 2012 Intracisternal interleukin 1 receptor antagonist prevents postoperative cognitive decline and neuroinflammatory response in aged rats J Neurosci 32 14641 14648 Bedford P 1955 Adverse cerebral effects of anaesthesia on old people Lancet 266 259 264 Benson R Minter L Osborne B Granowitz E 2003 Hyperbaric oxygen inhibits stimulus induced proinflammatory cytokine synthesis by human blood derived monocyte macrophages Clin Exp Immunol 134 57 62 Berger M Nadler JW Browndyke J Terrando N Ponnusamy V Cohen HJ Whitson HE Mathew JP 2015 Postoperative cognitive dysfunction minding the gaps in our knowledge of a common postoperative complication in the elderly Anesthesiol Clin 33 517 550 Borovikova LV Ivanova S Zhang M Yang H Botchkina GI Watkins LR Wang H Abumrad N Eaton JW Tracey KJ 2000 Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin Nature 405 458 462 Buras JA Stahl GL Svoboda KK Reenstra WR 2000 Hyperbaric oxygen downregulates ICAM 1 expression induced by hypoxia and hypoglycemia the role of NOS Am J Physiol Cell Physiol 278 C292 C302 Buras JA Holt D Orlow D Belikoff B Pavlides S Reenstra WR 2006 Hyperbaric oxygen protects from sepsis mortality via an interleukin 10 dependent mechanism Crit Care Med 34 2624 2629 Calabrese V Mancuso C Calvani M Rizzarelli E Butterfield DA Stella AMG 2007 Nitric oxide in the central nervous system neuroprotection versus neurotoxicity Nat Neurosci 8 766 775 Cao L Li L Lin D Zuo Z 2012 Isoflurane induces learning impairment that is mediated by interleukin 1 in rodents PLoS One 7 e51431 Chen Q Banick PD Thom SR 1996 Functional inhibition of rat polymorphonuclear leukocyte B2 integrins by hyperbaric oxygen is associated with impaired cGMP synthesis J Pharmacol Exp Ther 276 929 933 Cheng O Ostrowski RP Wu B Liu W Chen C Zhang JH 2011 Cyclooxygenase 2 mediates hyperbaric oxygen preconditioning in the rat model of transient global cerebral ischemia Stroke 42 484 490 334 Cibelli M Fidalgo AR Terrando N Ma D Monaco C Feldmann M Takata M Lever IJ Nanchahal J Fanselow MS 2010 Role of interleukin 1 in postoperative cognitive dysfunction Ann Neurol 68 360 368 Daniel RAF Cardoso VK G is Jr E Parra RS Garcia SB Rocha JJRd F res O 2011 Effect of hyperbaric oxygen therapy on the intestinal ischemia reperfusion injury Acta Cir Bras 26 463 469 Dennog C Radermacher P Barnett YA Speit G 1999 Antioxidant status in humans after exposure to hyperbaric oxygen Mutat Res 428 83 89 Dong H Xiong L Zhu Z Chen S Hou L Sakabe T 2002 Preconditioning with hyperbaric oxygen and hyperoxia induces tolerance against spinal cord ischemia in rabbits Anesthesiology 96 907 912 Dong Y Zhang G Zhang B Moir RD Xia W Marcantonio ER Culley DJ Crosby G Tanzi RE Xie Z 2009 The common inhalational anesthetic sevoflurane induces apoptosis and increases amyloid protein levels Arch Neurol 66 620 631 Eckenhoff RG Johansson JS Wei H Carnini A Kang B Wei W Pidikiti R Keller JM Eckenhoff MF 2004 Inhaled anesthetic enhancement of amyloid beta oligomerization and cytotoxicity Anesthesiology 101 703 709 Edwards ML 2010 Hyperbaric oxygen therapy Part 1 history and principles J Vet Emerg Crit Care 20 284 288 Fidalgo AR Cibelli M White JP Nagy I Maze M Ma D 2011 Systemic inflammation enhances surgery induced cognitive dysfunction in mice Neurosci Lett 498 63 66 Ghia JE Blennerhassett P El Sharkawy RT Collins SM 2007 The protective effect of the vagus nerve in a murine model of chronic relapsing colitis Am J Physiol Gastrointest Liver Physiol 293 G711 718 Godman CA Joshi R Giardina C Perdrizet G Hightower LE 2010a Hyperbaric oxygen treatment induces antioxidant gene expression Ann N Y Acad Sci 1197 178 183 Godman CA Chheda KP Hightower LE Perdrizet G Shin D G Giardina C 2010b Hyperbaric oxygen induces a cytoprotective and angiogenic response in human microvascular endothelial cells Cell Stress Chaperones 15 431 442 Hanning C 2005 Postoperative cognitive dysfunction Br J Anaesth 95 82 87 He HJ Wang Y Le Y Duan KM Yan XB Liao Q Liao Y Tong JB Terrando N Ouyang W 2012 Surgery upregulates high mobility group box 1 and disrupts the blood brain barrier causing cognitive dysfunction in aged rats CNS Neurosci Ther 18 994 1002 He X Xu X Fan M Chen X Sun X Luo G Chen L Mu Q Feng Y Mao Q 2011 Preconditioning with hyperbaric oxygen induces tolerance against renal ischemia reperfusion injury via increased expression of heme oxygenase 1 J Surg Res 170 e271 277 Hovens IB Schoemaker RG van der Zee EA Absalom AR Heineman E van Leeuwen BL 2014 Postoperative cognitive dysfunction Involvement of neuroinflammation and neuronal functioning Brain Behav Immun 38 202 210 Hshieh TT Fong TG Marcantonio ER Inouye SK 2008 Cholinergic deficiency hypothesis in delirium a synthesis of current evidence J Gerontol A Biol Sci Med Sci 63 764 772 Hu Q Manaenko A Xu T Guo Z Tang J Zhang JH 2016 Hyperbaric oxygen therapy for traumatic brain injury bench to bedside Med Gas Res 6 102 110 Hu SL Huang YX Hu R Li F Feng H 2015 Osteopontin mediates hyperbaric oxygen preconditioning induced neuroprotection against ischemic stroke Mol Neurobiol 52 236 243 Huang G Xu J Xu L Wang S Li R Liu K Zheng J Cai Z Zhang K Luo Y 2014 Hyperbaric oxygen preconditioning induces tolerance against oxidative injury and oxygen glucose deprivation by up regulating heat shock protein 32 in rat spinal neurons PLoS One 9 e85967 Huang WT Lin MT Chang CP 2006 An NMDA receptor dependent hydroxyl radical pathway in the rabbit hypothalamus may mediate lipopolysaccharide fever Neuropharmacology 50 504 511 Inouye SK 2006 Delirium in older persons N Engl J Med 354 11571165 Kalns J Lane J Delgado A Scruggs J Ayala E Gutierrez E Warren D Niemeyer D Wolf EG Bowden RA 2002 Hyperbaric oxygen exposure temporarily reduces Mac 1 mediated functions of human neutrophils Immunol Lett 83 125 131

Page 110

Gao et al Neural Regeneration Research 2017 12 2 329 336 Kang N Hai Y Liang F Gao CJ Liu XH 2014 Preconditioned hyperbaric oxygenation protects skin flap grafts in rats against ischemia reperfusion injury Mol Med Report 9 2124 2130 Kim CH Choi H Chun YS Kim GT Park JW Kim MS 2001 Hyperbaric oxygenation pretreatment induces catalase and reduces infarct size in ischemic rat myocardium Pfl gers Archiv 442 519 525 Kindwall EP Hunt TK 1995 Hyperbaric medicine practice Plast Reconstr Surg 96 985 Kindwall EP Wheland HT 1999 Hyperbaric medicine practice Best Publishing Company Kocao ullar Y st n ME Avci E Karabacakoglu A Fossett D 2004 The role of hyperbaric oxygen in the management of subarachnoid hemorrhage Intensive Care Med 30 141 146 L ndahl M 2012 Hyperbaric oxygen therapy as treatment of diabetic foot ulcers Diabetes Metab Res Rev 28 78 84 Labrouche S Javorschi S Leroy D Gbikpi Benissan G Freyburger G 1999 Influence of hyperbaric oxygen on leukocyte functions and haemostasis in normal volunteer divers Thromb Res 96 309 315 Lahat N Bitterman H Yaniv N Kinarty A Bitterman N 1995 Exposure to hyperbaric oxygen induces tumour necrosis factor alpha TNF secretion from rat macrophages Clin Exp Immunol 102 655 659 Li J Liu W Ding S Xu W Guan Y Zhang JH Sun X 2008 Hyperbaric oxygen preconditioning induces tolerance against brain ischemia reperfusion injury by upregulation of antioxidant enzymes in rats Brain Res 1210 223 229 Li Q Li J Zhang L Wang B Xiong L 2007 Preconditioning with hyperbaric oxygen induces tolerance against oxidative injury via increased expression of heme oxygenase 1 in primary cultured spinal cord neurons Life Sci 80 1087 1093 Li Y Dong H Chen M Liu J Yang L Chen S Xiong L 2011 Preconditioning with repeated hyperbaric oxygen induces myocardial and cerebral protection in patients undergoing coronary artery bypass graft surgery a prospective randomized controlled clinical trial J Cardiothorac Vasc Anesth 25 908 916 Lin H Chang CP Lin HJ Lin MT Tsai CC 2012a Attenuating brain edema hippocampal oxidative stress and cognitive dysfunction in rats using hyperbaric oxygen preconditioning during simulated high altitude exposure J Trauma Acute Care Surg 72 1220 1227 Lin KC Niu KC Tsai KJ Kuo JR Wang LC Chio CC Chang CP 2012b Attenuating inflammation but stimulating both angiogenesis and neurogenesis using hyperbaric oxygen in rats with traumatic brain injury J Trauma Acute Care Surg 72 650 659 Liu W Liu K Tao H Chen C Zhang JH Sun X 2012 Hyperoxia preconditioning the next frontier in neurology Neurol Res 34 415421 Lu P Feng H Yuan S Zhang R Li M Hu R Liu Z Yin J 2013 Effect of preconditioning with hyperbaric oxygen on neural cell apoptosis after spinal cord injury in rats J Neurosurg Sci 57 253 258 Lu PG Hu SL Hu R Wu N Chen Z Meng H Lin JK Feng H 2012 Functional recovery in rat spinal cord injury induced by hyperbaric oxygen preconditioning Neurol Res 34 944 951 Lu SM Gui B Dong HQ Zhang X Zhang SS Hu LQ Liu HL Sun J Qian YN 2015 Prophylactic lithium alleviates splenectomy induced cognitive dysfunction possibly by inhibiting hippocampal TLR4 activation in aged rats Brain Res Bull 114 31 41 M ller S Krause N Schmidt M M nte T M nte S 2004 Cognitive dysfunction after abdominal surgery in elderly patients Z Gerontol Geriatr 37 475 485 Ma Y Cheng Q Wang E Li L Zhang X 2015 Inhibiting tumor necrosis factor signaling attenuates postoperative cognitive dysfunction in aged rats Mol Med Report 12 3095 3100 Malik AB Lo SK 1996 Vascular endothelial adhesion molecules and tissue inflammation Pharmacol Rev 48 213 229 Matsunami T Sato Y Sato T Ariga S Shimomura T Yukawa M 2010 Oxidative stress and gene expression of antioxidant enzymes in the streptozotocin induced diabetic rats under hyperbaric oxygen exposure Int J Clin Exp Pathol 3 177 Matsunami T Sato Y Hasegawa Y Ariga S Kashimura H Sato T Yukawa M 2011 Enhancement of reactive oxygen species and induction of apoptosis in streptozotocin induced diabetic rats under hyperbaric oxygen exposure Int J Clin Exp Pathol 4 255 Maulik N 2002 Redox signaling of angiogenesis Antioxid Redox Signal 4 805 815 McDonagh DL Mathew JP White WD Phillips Bute B Laskowitz DT Podgoreanu MV Newman MF 2010 Cognitive function after major noncardiac surgery apolipoprotein E4 genotype and biomarkers of brain injury Anesthesiology 112 852 Micarelli A Jacobsson H Larsson S Jonsson C Pagani M 2013 Neurobiological insight into hyperbaric hyperoxia Acta Physiologica 209 69 76 Mileski W Winn R Vedder N Pohlman T Harlan J Rice C 1990 Inhibition of CD18 dependent neutrophil adherence reduces organ injury after hemorrhagic shock in primates Surgery 108 206 212 Moller J Cluitmans P Rasmussen L Houx P Rasmussen H Canet J Rabbitt P Jolles J Larsen K Hanning C 1998 Long term postoperative cognitive dysfunction in the elderly ISPOCD1 study Lancet 351 857 861 Monk TG Weldon BC Garvan CW Dede DE Van Der Aa MT Heilman KM Gravenstein JS 2008 Predictors of cognitive dysfunction after major noncardiac surgery Anesthesiololy 108 18 30 Morykwas MJ Argenta L 1996 Nonsurgical modalities to enhance healing and care of soft tissue wounds J South Orthop Assoc 6 279 288 Newman MF Kirchner JL Phillips Bute B Gaver V Grocott H Jones RH Mark DB Reves JG Blumenthal JA 2001 Longitudinal assessment of neurocognitive function after coronary artery bypass surgery N Engl J Med 344 395 402 Newman S Stygall J Hirani S Shaefi S Maze M 2007 Postoperative cognitive dysfunction after noncardiac surgery a systematic review Anesthesiology 106 572 590 Nie H Xiong L Lao N Chen S Xu N Zhu Z 2006 Hyperbaric oxygen preconditioning induces tolerance against spinal cord ischemia by upregulation of antioxidant enzymes in rabbits J Cereb Blood Flow Metab 26 666 674 Niu KC Huang WT Lin MT Huang KF 2009 Hyperbaric oxygen causes both antiinflammation and antipyresis in rabbits Eur J Pharmacol 606 240 245 Padgaonkar VA Giblin FJ Fowler K Leverenz VR Reddan JR Dziedzic DC 1997 Heme oxygenase synthesis is induced in cultured lens epithelium by hyperbaric oxygen or puromycin Exp Eye Res 65 435 443 Palzur E Soliman K Vaya J Chezar I Michelis R Sela S 2011 Effects of hyperbaric oxygen HBO preconditioning on plasma constituents Free Radic Biol Med 51 S97 S98 Peng Y Feng SF Wang Q Wang HN Hou WG Xiong L Luo ZJ Tan QR 2010 Hyperbaric oxygen preconditioning ameliorates anxiety like behavior and cognitive impairments via upregulation of thioredoxin reductases in stressed rats Prog Neuropsychopharmacol Biol Psychiatry 34 1018 1025 Rothfuss A Radermacher P Speit G 2001 Involvement of heme oxygenase 1 HO 1 in the adaptive protection of human lymphocytes after hyperbaric oxygen HBO treatment Carcinogenesis 22 1979 1985 Rudolph JL Ramlawi B Kuchel GA McElhaney JE Xie D Sellke FW Khabbaz K Levkoff SE Marcantonio ER 2008 Chemokines are associated with delirium after cardiac surgery J Gerontol A Biol Sci Med Sci 63 184 189 Selnes OA Gottesman RF Grega MA Baumgartner WA Zeger SL McKhann GM 2012 Cognitive and neurologic outcomes after coronary artery bypass surgery N Engl J Med 366 250 257 Shoair OA Grasso II MP Lahaye LA Daniel R Biddle CJ Slattum PW 2015 Incidence and risk factors for postoperative cognitive dysfunction in older adults undergoing major noncardiac surgery A prospective study J Anaesthesiol Clin Pharmacol 31 30 Simsek K Ay H Topal T Ozler M Uysal B Ucar E Acikel CH Yesilyurt O Korkmaz A Oter S 2011 Long term exposure to repetitive hyperbaric oxygen results in cumulative oxidative stress in rat lung tissue Inhal Toxicol 23 166 172 Steinmetz J Christensen KB Lund T Lohse N Rasmussen LS 2009 Long term consequences of postoperative cognitive dysfunction Anesthesiology 110 548 555 Stetler RA Leak RK Gan Y Li P Zhang F Hu X Jing Z Chen J Zigmond MJ Gao Y 2014 Preconditioning provides neuroprotection in models of CNS disease paradigms and clinical significance Prog Neurobiol 114 58 83 335

Page 111

Gao et al Neural Regeneration Research 2017 12 2 329 336 Sun L Xie K Zhang C Song R Zhang H 2014 Hyperbaric oxygen preconditioning attenuates postoperative cognitive impairment in aged rats Neuroreport 25 718 724 Szuchman A Aviram M Soliman K Tamir S Vaya J 2006 Exogenous N linoleoyl tyrosine marker as a tool for the characterization of cellular oxidative stress in macrophages Free Radic Res 40 41 52 Terrando N Monaco C Ma D Foxwell BM Feldmann M Maze M 2010 Tumor necrosis factor triggers a cytokine cascade yielding postoperative cognitive decline Proc Natl Acad Sci U S A 107 2051820522 Terrando N Eriksson LI Kyu Ryu J Yang T Monaco C Feldmann M Jonsson Fagerlund M Charo IF Akassoglou K Maze M 2011 Resolving postoperative neuroinflammation and cognitive decline Ann Neurol 70 986 995 Thom S Mendiguren I Hardy K Bolotin T Fisher D Nebolon M Kilpatrick L 1997 Inhibition of human neutrophil beta2 integrin dependent adherence by hyperbaric O2 Am J Physiol Cell Physiol 272 C770 777 Thom SR 1993 Functional inhibition of leukocyte B 2 integrins by hyperbaric oxygen in carbon monoxide mediated brain injury in rats Toxicol Appl Pharmacol 123 248 256 Thom SR 2009 Oxidative stress is fundamental to hyperbaric oxygen therapy J Appl Physiol 106 988 995 Thom SR Bhopale VM Mancini DJ Milovanova TN 2008 Actin S nitrosylation inhibits neutrophil 2 integrin function J Biol Chem 283 10822 10834 Tian X 2015 Variations of brain edema and neurological function of rat models of cerebral infarction after hyperbaric oxygen therapy Zhongguo Zuzhi Gongcheng Yanjiu 19 6423 6428 Tian X Zhang L Wang J Dai J Shen S Yang L Huang P 2013 The possible protective mechanism of hyperbaric oxygen HBO in memory impairments induced by A 25 35 in rats Open Med 8 468 475 Tibbles PM Edelsberg JS 1996 Hyperbaric oxygen therapy N Engl J Med 334 1642 1648 Ushio Fukai M Alexander RW 2004 Reactive oxygen species as mediators of angiogenesis signaling Role of NAD P H oxidase Mol Cell Biochem 264 85 97 Vacas S Degos V Feng X Maze M 2013 The neuroinflammatory response of postoperative cognitive decline Br Med Bull 106 161 178 van Maanen MA Lebre MC van der Poll T LaRosa GJ Elbaum D Vervoordeldonk MJ Tak PP 2009 Stimulation of nicotinic acetylcholine receptors attenuates collagen induced arthritis in mice Arthritis Rheum 60 114 122 Verma R Chopra A Giardina C Sabbisetti V Smyth JA Hightower LE Perdrizet GA 2015 Hyperbaric oxygen therapy HBOT suppresses biomarkers of cell stress and kidney injury in diabetic mice Cell Stress Chaperones 20 495 505 Wad K Ito M Miyazawa T Katoh H Nawashiro H Shima K Chigasaki H 1996 Repeated hyperbaric oxygen induces ischemic tolerance in gerbil hippocampus Brain Res 740 15 20 Wada K Miyazawa T Nomura N Tsuzuki N Nawashiro H Shima K 2001 Preferential conditions for and possible mechanisms of induction of ischemic tolerance by repeated hyperbaric oxygenation in gerbil hippocampus Neurosurgery 49 160 167 Wan Y Xu J Ma D Zeng Y Cibelli M Maze M 2007 Postoperative impairment of cognitive function in rats a possible role for cytokine mediated inflammation in the hippocampus Anesthesiology 106 436 443 Wang L Li W Kang Z Liu Y Deng X Tao H Xu W Li R Sun X Zhang JH 2009 Hyperbaric oxygen preconditioning attenuates early apoptosis after spinal cord ischemia in rats J Neurotrauma 26 55 66 336 Wilson B McLaughlin L Nair AR Dange R Francis J 2013 Inflammation oxidative stress and neuroprotective factors in the pathophysiology of PTSD in an animal model FASEB J 27 691 695 Xiong L Zhu Z Dong H Hu W Hou L Chen S 2000 Hyperbaric oxygen preconditioning induces neuroprotection against ischemia in transient not permanent middle cerebral artery occlusion rat model Chin Med J Engl 113 836 839 Yamashita M Yamashita M 2000 Hyperbaric oxygen treatment attenuates cytokine induction after massive hemorrhage Am J Physiol Endocrinol Metab 278 E811 816 Yan W Zhang H Bai X Lu Y Dong H Xiong L 2011 Autophagy activation is involved in neuroprotection induced by hyperbaric oxygen preconditioning against focal cerebral ischemia in rats Brain Res 1402 109 121 Yogaratnam JZ Laden G Guvendik L Cowen M Cale A Griffin S 2010 Hyperbaric oxygen preconditioning improves myocardial function reduces length of intensive care stay and limits complications post coronary artery bypass graft surgery Cardiovasc Revasc Med 11 8 19 Zamboni WA Roth AC Russell RC Graham B Suchy H Kucan JO 1993 Morphologic analysis of the microcirculation during reperfusion of ischemic skeletal muscle and the effect of hyperbaric oxygen Plast Reconstr Surg 91 1110 1123 Zhang J Jiang W Zuo Z 2014 Pyrrolidine dithiocarbamate attenuates surgery induced neuroinflammation and cognitive dysfunction possibly via inhibition of nuclear factor B Neuroscience 261 1 10 Zhang J Tan H Jiang W Zuo Z 2015 The choice of general anesthetics may not affect neuroinflammation and impairment of learning and memory after surgery in elderly rats J Neuroimmune Pharmacol 10 179 189 Zhang Q Gould LJ 2014 Hyperbaric oxygen reduces matrix metalloproteinases in ischemic wounds through a redox dependent mechanism J Invest Dermatol 134 237 246 Zhao Z Huang G Wang B Zhong Y 2013 Inhibition of NF kappaB activation by Pyrrolidine dithiocarbamate partially attenuates hippocampal MMP 9 activation and improves cognitive deficits in streptozotocin induced diabetic rats Behav Brain Res 238 44 47 Zheng X Ma Z Gu X 2015 Plasma levels of tumor necrosis factor in adolescent idiopathic scoliosis patients serve as a predictor for the incidence of early postoperative cognitive dysfunction following orthopedic surgery Exp Ther Med 9 1443 1447 Zhou BC Liu LJ Liu B 2016a Neuroprotection of hyperbaric oxygen therapy in sub acute traumatic brain injury not by immediately improving cerebral oxygen saturation and oxygen partial pressure Neural Regen Res 11 1445 1449 Zhou HX Liu ZG Liu XJ Chen QX 2016b Umbilical cord derived mesenchymal stem cell transplantation combined with hyperbaric oxygen treatment for repair of traumatic brain injury Neural Regen Res 11 107 113 Zhou L Wang Z Zhou H Liu T Lu F Wang S Li J Peng S Zuo Z 2015 Neonatal exposure to sevoflurane may not cause learning and memory deficits and behavioral abnormality in the childhood of Cynomolgus monkeys Sci Rep 5 11145 Zhu JY Yin GQ Pang JJ Chen ZX Pan XY Lu SD Wei QX Xie ZD 2016 Effect of hyperbaric oxygen pretreatment on the expressions of vascular endothelial growth factor and transforming growth factor beta in over length dorsal random skin flaps Zhongguo Zuzhi Gongcheng Yanjiu 20 1525 1531 Copyedited by Phillips A Robens J Wang J Li CH Qiu Y Song LP Zhao M

Page 112

Available online at www annclinlabsci org 158 Annals of Clinical Laboratory Science vol 48 no 2 2018 The Effect of Hyperbaric Oxygen Therapy on Myocardial Perfusion after the Implantation of Drug Eluting Stents Yuan Li1 Yafeng Hao2 Tao Wang3 Lingge Wei4 Wei Wang5 Yi Liang5 and Xuan Guo6 1Department of Cardiology The Fourth Hospital of Shijiazhuang 2Department of Cardiology The First Hospital of Handan 3Department of Cardiology The Third Hospital of Hebei Medical University 4Department of Nuclear The Third Hospital of Hebei Medical University 5Department of Hyperbaric Oxygen The Third Hospital of Hebei Medical University and 6Department of Emergency The Third Hospital of Hebei Medical University Hebei Province China Abstract Aim The study is to investigate hyperbaric oxygen therapy HBOT on myocardial perfusion of patients after the implantation of drug eluting stents DES Methods From December 2013 to December 2015 a total of 115 patients with CAD who received DES implantation were included in this retrospective study They were divided into HBOT group n 55 and control group n 60 according to different treatments retrospectively Gated myocardial perfusion single photon emission computed tomography SPECT was conducted in all the patients Endothelin 1 ET 1 high sensitivity C reactive protein hsCRP and nitric oxide NO were detected by the corresponding assay kits Results After HBOT treatment in HBOT group SPECT results showed that the improvement rate of impaired sub segments in patients of HBOT was significantly higher than that in control group P

Page 113

The HBOT on myocardial perfusion 159 Table 1 Basic characteristic of the patients Sex Male Female Age years Body mass index kg m2 History of CAD n Fasting blood glucose mmol L TC mmol L LDL C mmol L HDL C mmol L Heart rate bpm Hypertension n Smoking history n HBOT group n 55 Control group n 50 P value 32 23 58 20 10 26 27 37 2 96 19 5 27 0 71 4 79 0 78 2 92 0 67 1 99 0 47 69 10 25 15 36 24 57 10 9 52 28 25 3 98 22 5 30 0 74 4 89 0 70 3 02 0 63 1 91 0 38 71 10 29 17 0 843 0 5521 0 1844 0 812 0 8252 0 4702 0 4112 0 3159 0 2863 0 757 0 899 Abbreviations CAD coronary artery disease TC serum total cholesterol LDL C low density lipoprotein cholesterol HDL C high density lipoprotein cholesterol Table 2 The comparison of impaired cardiac sub segments HBOT group n 55 Control group n 50 Impaired sub segments Improved sub segments 178 181 126 88 Effective rate 70 79 48 62 P value 0 031 Abbreviations HBOT hyperbaric oxygen therapy Hemodynamic stability was referred to peripheral circulation performed well and blood pressure and heart rate stable The patients were divided into a HBOT group n 55 and control group n 60 according to different treatments HBOT group n 55 and a control group n 60 The inclusion criteria were 1 42 years old age 71 years old 2 coronary stenosis 90 3 90 left main coronary stenosis 50 4 90 proximal anterior descending coronary stenosis 70 4 90 any vessel stenosis 70 with angina after medication therapy The exclusion criteria were 1 receiving hypolipidemic drugs anticoagulants or non steroidal anti inflammatory drugs NSAID within 2 months before the study 2 concomitant infection tumors and diseases of the immune system 3 hepatic or renal insufficiency 4 prior surgical bypass or PCI surgeries 5 other cardiac diseases or contraindication to surgical treatment Treatments All the patients received aspirin 100 mg day Bayer Healthcare Co Ltd Germany ticagrelor 180 mg day AstraZeneca Pharmaceutical Co Ltd UK metoprolol tartrate 50 mg day AstraZeneca Pharmaceutical Co Ltd UK isosorbide mononitrate 40 mg day Lunan Beite Pharmaceutical Co Ltd China atorvastatin 20 mg day Pfizer Pharmaceuticals Ltd USA 3 days before surgery The medication therapy would be administrated for 12 months after surgery The DES implantations were conducted by the same surgeons according to the standard techniques Proce dural success was defined as the successful deployment of the stent increased lumen diameter of the culprit vessels residual diameter stenosis

Page 114

160 Annals of Clinical Laboratory Science vol 48 no 2 2018 SPECT imaging was administrated 1 5 h later The image examination was performed by a dual detector SPECT imaging system with low energy high resolution parallel hole collimators Infinia Hawkeye 4 GE Healthcare Piscataway NJ USA The parameters of peak filling rate PFR time of peak filling rate TPFR mean filling rate during the first third of the filling time MFR 3 left ventricular end diastolic volume LVEDV left ventricular end systolic volume LVESV left ventricular ejection fraction LVEF were calculated using commercial software packages Quantitative Gated SPECT GE Healthcare We divided left ventricle into 7 segments including the apex inferior wall anterior wall anterolateral wall inferior lateral wall anterior septal wall and inferior septal wall The 7 segments were further divided into 20 sub segments The summed rest score SRS with 5 point scoring system for perfusion defect severity was listed as follows 0 normal uptake of 99Tcm MIBI 1 mildly reduced uptake 2 moderately reduced uptake 3 severely reduced uptake 4 absence uptake Subsegments with increased scores represented an improvement Laboratory tests Endothelin 1 ET 1 and high sensitivity C reactive protein hs CRP were detected by ELISA kits ET 1 ELISA kit Yuanye biotechnology Co Ltd China hs CRP ELISA kit Hengyuan biotechnology Co Ltd China according to the manufacturer s instructions Nitric oxide NO was detected by nitrate reductase method NO assay kit Nanjing Jiancheng Bioengineering Institute China Statistical analysis Statistical analysis was done using the SPSS software version 16 0 SPSS Inc Chicago IL Continuous data were expressed as means standard deviation Continuous variables were statistically analyzed by Student s t test Categorical variables were assessed by chi square analysis Statistical findings were considered significant if the P value was 0 05 Gated myocardial perfusion SPECT imaging results Patients in the two groups have similar numbers of impaired cardiac sub segments before surgery while the number of improved sub segments were notably increased in patients of the HBOT group after receiving 4 week oxygen treatments compared with the control group P

Page 115

Page 116

162 Annals of Clinical Laboratory Science vol 48 no 2 2018 Gated myocardial perfusion SPECT imaging is an accurate and non invasive procedure to detect coronary diseases such as CHD and coronary artery stent restenosis 14 The uptake of these radionuclides in myocardial cells is proportional to myocardial blood flow and myocyte integrity It has high sensitivity and specificity to evaluate myocardial viability and myocardial blood perfusion which has recommended in many guidelines 15 In our study we chose gated myocardial perfusion SPECT imaging to detect the myocardial injury The markedly reduced numbers of impaired cardiac sub segments and statistical increase of PFR TPFR and MMFR 3 were occurred in the HBOT group after oxygen treatment indicating that hyperbaric oxygen could significantly improve myocardial blood perfusion and ventricular diastolic function Li et al 16 demonstrated that HBO may decrease ischemia reperfusion injury by upregulation of endogenous antioxidative enzymes such as superoxide dismutase and catalase HBO may also stimulate the release of fibrinolytic factors leading to prevention of thromboses and or microembolization 17 All the mentioned mechanism may involve in the improvement of cardiac function in our study more detailed investigations need to be done Our study has some limitations Firstly the parameters of LVEDV LVESV and LVEF were shown with no significant differences between groups during the perioperative period It may due to the shorter time for illness the ventricular systolic function haven t been markedly involved The small sample size is another limitation What s more the retrospective study might affect the results due to unmeasured confounder Furthermore the adverse reaction of hyperbaric oxygen including pressure injury oxygen toxicity decompression sickness et al In order to make sure the treatment performed well some matters should be attended in the treatment process 1 The pressure of hyperbaric oxygen should be less than 0 2 Mpa 2 Pressure should be slowly and smoothly increased and reduced 3 Pressure should be regulated 4 The oxygen inhalation mask resistance should not be excessive 5 Medicine should be given isosorbitone nitrate before entering the capsule Conclusions The present findings imply that HBO may improve myocardial blood perfusion reduce inflammation and vascular endothelial dysfunction and further improve myocardial microcirculation in patients after the implantation of DES We recommended the use of HBO in patients with hemodynamic stability 24 hours after PCI Acknowledgements The research is supported by the Sciences and Technologies Project Research Plan of Hebei Public Health Department grant number is 20120173 References 1 2 3 4 5 6 7 8 9 10 11 Roth GA Forouzanfar MH Moran AE Barber R Nguyen G Feigin VL Naghavi M Mensah GA Murray CJ Demographic and epidemiologic drivers of global cardiovascular mortality N Engl J Med 2015 372 1333 1341 Mortality GBD Causes of Death C Global regional and national age sex specific all cause and cause specific mortality for 240 causes of death 1990 2013 a systematic analysis for the Global Burden of Disease Study 2013 Lancet 2015 385 117 171 Yogaratnam JZ Laden G Guvendik L Cowen M Cale A Griffin S Hyperbaric oxygen preconditioning improves myocardial function reduces length of intensive care stay and limits complications post coronary artery bypass graft surgery Cardiovasc Revasc Med 2010 11 8 19 Al Waili NS Butler GJ Beale J Abdullah MS Hamilton RW Lee BY Lucus P Allen MW Petrillo RL Carrey Z Finkelstein M Hyperbaric oxygen in the treatment of patients with cerebral stroke brain trauma and neurologic disease Adv Ther 2005 22 659 678 Huang CC Ho CH Chen YC Lin HJ Hsu CC Wang JJ Su SB Guo HR Hyperbaric oxygen therapy is associated with lower short and long term mortality in patients with carbon monoxide poisoning Chest 2017 Losada DM Chies AB Feres O Chaib E D Albuquerque LA Castro e Silva O Effects of hyperbaric oxygen therapy as hepatic preconditioning in rats submitted to hepatic ischemia reperfusion injury Acta Cir Bras 2014 29 Suppl 2 61 66 Bennett MH Lehm JP Jepson N Hyperbaric oxygen therapy for acute coronary syndrome Cochrane Database Syst Rev 2015 CD004818 Chen Z Chen X Li S Huo X Fu X Dong X Nicorandil improves myocardial function by regulating plasma nitric oxide and endothelin 1 in coronary slow flow Coron Artery Dis 2015 26 114 120 Serizawa K Yogo K Aizawa K Tashiro Y Ishizuka N Nicorandil prevents endothelial dysfunction due to antioxidative effects via normalisation of NADPH oxidase and nitric oxide synthase in streptozotocin diabetic rats Cardiovasc Diabetol 2011 10 105 Ramzy D Rao V Tumiati LC Xu N Sheshgiri R Miriuka S Delgado DH Ross HJ Elevated endothelin 1 levels impair nitric oxide homeostasis through a PKC dependent pathway Circulation 2006 114 I319 326 Thengchaisri N Hein TW Ren Y Kuo L Endothelin 1 impairs coronary arteriolar dilation Role of p38 kinase mediated superoxide production from NADPH oxidase J Mol Cell Cardiol 2015 86 75 84

Page 117

The HBOT on myocardial perfusion 12 Patel VB Robbins MA Topol EJ C reactive protein a golden marker for inflammation and coronary artery disease Cleve Clin J Med 2001 68 521 524 527 534 13 Seyedian SM Ahmadi F Dabagh R Davoodzadeh H Relationship between high sensitivity C reactive protein serum levels and the severity of coronary artery stenosis in patients with coronary artery disease ARYA Atheroscler 2016 12 231 237 14 Zhang P Chen S Li Y Du Q Wang L Sun Y Li Y Adenosine triphosphate stress 99mTc methoxyisobutylisonitrile gated myocardial perfusion imaging efficacy in diagnosing stent restenosis following coronary stent implantation Exp Ther Med 2016 12 3897 3904 15 Hendel RC Berman DS Di Carli MF Heidenreich PA Henkin RE Pellikka PA Pohost GM Williams KA American College of Cardiology Foundation Appropriate Use Criteria Task F American Society of Nuclear C American College of R American Heart A American Society of E Society of Cardiovascular Computed T Society for Cardiovascular 16 17 163 Magnetic R Society of Nuclear M ACCF ASNC ACR AHA ASE SCCT SCMR SNM 2009 appropriate use criteria for cardiac radionuclide imaging a report of the American College of Cardiology Foundation Appropriate Use Criteria Task Force the American Society of Nuclear Cardiology the American College of Radiology the American Heart Association the American Society of Echocardiography the Society of Cardiovascular Computed Tomography the Society for Cardiovascular Magnetic Resonance and the Society of Nuclear Medicine Circulation 2009 119 e561 587 Li J Liu W Ding S Xu W Guan Y Zhang JH Sun X Hyperbaric oxygen preconditioning induces tolerance against brain ischemia reperfusion injury by upregulation of antioxidant enzymes in rats Brain Res 2008 1210 223 229 Tjarnstrom J Holmdahl L Falk P Falkenberg M Arnell P Risberg B Effects of hyperbaric oxygen on expression of fibrinolytic factors of human endothelium in a simulated ischaemia reperfusion situation Scand J Clin Lab Invest 2001 61 539 545

Page 118

Page 119

Page 120

Page 121

Page 122

Page 123

Page 124

Page 125

Page 126

Page 127

Page 128

Page 129

Page 130

Page 131

Page 132

Page 133

Page 134

Page 135

Page 136

Page 137

Page 138

Page 139

Page 140

Page 141

Page 142

Page 143

Page 144

Page 145

Page 146

Page 147

Page 148

Page 149

Page 150

Page 151

Page 152

Page 153

Page 154

Page 155

Page 156

Page 157

Page 158

Page 159

Page 160

Page 161

Page 162

Page 163

Page 164

Page 165

Page 166

Page 167

Page 168

Page 169

Page 170

Page 171

Page 172

Page 173

Page 174

Page 175

Page 176

Page 177

Page 178

Page 179

Page 180

Page 181

Page 182

Page 183

Page 184

Page 185

Page 186

Page 187

Page 188

Page 189

Page 190

Page 191

4254 MOLECULAR MEDICINE REPORTS 22 4254 4264 2020 Hyperbaric oxygen protects against myocardial ischemia reperfusion injury through inhibiting mitochondria dysfunction and autophagy WAN CHEN1 LIWEN LV1 ZHIHUAN NONG2 XIAOYU CHEN2 XIAORONG PAN3 and CHUNXIA CHEN3 Departments of 1Emergency 2Pharmacy and 3Hyperbaric Oxygen The People s Hospital of Guangxi Zhuang Autonomous Region Nanning Guangxi 530021 P R China Received May 22 2019 Accepted June 22 2020 DOI 10 3892 mmr 2020 11497 Abstract Our previous study demonstrated that hyperbaric oxygen HBO improves heart function predominantly through reducing oxygen stress modulating energy metabolism and inhibiting cell apoptosis The present study aimed to investigate the protective effects of HBO on mitochondrial function and autophagy using rats with a ligated left anterior descending artery The cardioprotective effects of HBO were mainly evaluated using and reverse transcription quantitative PCR RT qPCR HBO pretreatment for 14 days once a day using a 0 25 MPa chamber improved mitochondrial morphology and decreased the number of autophagic vesicles as observed using a transmission electron of ATP ADP energy charge and the opening of the mitochondrial permeability transition pore but decreased the levels of AMP cytochrome c and reactive oxygen species Moreover HBO sion levels of eIF4E binding protein 1 mammalian target of rapamycin mTOR mitochondrial DNA NADH dehydrogenase subunit 1 mitofusin 1 and mitofusin 2 whereas it decreased the gene or protein expression levels of autophagy related 5 Atg5 cytochrome c dynamin related protein 1 and p53 as determined using RT qPCR or immunohistochemistry In conclusion HBO treatment was observed to protect cardiomyocytes during myocardial ischemia reperfusion injury MIRI by preventing mitochondrial dysfunction and inhibiting autophagy Thus these results provide novel evidence to support the use of HBO as a potential agent for the mitigation of MIRI Correspondence to Dr Chunxia Chen Department of Hyperbaric Oxygen The People s Hospital of Guangxi Zhuang Autonomous Region 6 Taoyuan Road Nanning Guangxi 530021 P R China E mail chunxia251401 126 com Contributed equally Key words hyperbaric oxygen myocardial ischemia reperfusion injury mitochondria function autophagy Introduction Coronary artery ischemic disease is prevalent worldwide 1 it affects 15 million adults in the United States 2 A lack of coronary blood supply caused by thrombosis or the acute alteration of coronary atherosclerotic plaques contributes to myocardial ischemia MI 3 The early restoration of blood flow is a common treatment strategy 4 however it can also cause further severe cardiac damage which is referred to as myocardial ischemia reperfusion injury MIRI 5 6 Therefore it is of great importance to further investigate safe and effective novel therapeutic treatments to prevent MIRI and improve the clinical outcomes of acute MI It is well established that mitochondria are the powerhouses of the cell due to their crucial role in generating ATP 7 but they are also important regulators of programmed cell death pathways 8 Properties of mitochondrial dysfunction include a reduction in energy charge EC the opening of the mitochondrial permeability transition pore mPTP the release of cytochrome c and Ca 2 overload 9 These properties subsequently lead to mitochondrial membrane depolarization the homeostatic imbalance between apoptotic proteins and ultimately cardiomyocyte death 10 Reactive oxygen species ROS of which mitochondria are the predominant source induce MIRI through mitochondrial DNA mtDNA damage reducing energy production and inhibiting protein synthesis through a vicious circle of mitochondrial damage 11 12 In addition mitochondria are dynamic organelles that continu proteins for example dynamin related protein 1 Drp 1 which is a cytosolic GTPase that serves a fundamental role in mitomembrane to generate the force necessary for mitochondrial which are required for the membrane remodeling processes necessary for mitochondrial fusion 17 18 Autophagy is an evolutionarily conserved lysosome dependent degradation process that is activated during MIRI 19 It has been reported that autophagy serves a dual role in MIRI A slight induction of autophagy promotes cell

Page 192

CHEN et al HYPERBARIC OXYGEN PROTECTS AGAINST MYOCARDIAL ISCHEMIA REPERFUSION INJURY cell death during reperfusion 20 21 Although a small amount of autophagy can maintain cell function excessive autophagy was found to promote myocardial injury due to the consumption of cellular constituents 22 Mammalian target of rapamycin mTOR kinase is an important regulator of the classical autophagy pathway 23 24 and autophagy related 5 Atg5 and microtubule associated protein 1A 1B light chain 3 LC3 conjugation systems are required for the formation of autophagic vesicles 25 Eukaryotic initiation factor 4E binding protein 1 4E BP1 binds to eukaryotic initiation factor 4E eIF4E 26 The phosphorylation of 4E BP1 disrupts the assembly of the eIF4E 4E BP1 complex which initiates eIF4E dependent translation and thereby the activation of cap dependent mRNA translation 27 In addition to regulating cell cycle checkpoints and apoptosis 28 p53 has also been demonstrated to mediate the transactivation of autophagy inducers 29 30 Hyperbaric oxygen HBO therapy is the clinical application of pure oxygen at a higher pressure usually 2 3 times atmospheric pressure in a chamber to treat ischemia or hypoxia associated diseases such as coronary heart disease cerebral infarction and carbon monoxide poisoning 31 34 HBO therapy has been widely agreed by major hyperbaric craft groups such as the Undersea and Hyperbaric Medical Society or the U S Food and Drug Administration 35 In addition data from our previous studies demonstrated that HBO exerted neuroprotective effects in certain animal models for example HBO combined with Madopar protected against 6 hydroxydopamine induced Parkinson s disease in rats 36 and HBO treatment also alleviated the withdrawal symptoms induced by morphine dependence 37 Moreover HBO prevented the cognitive impairments induced by D galactose 38 39 The protective effects of HBO are mainly associated with the increased induction of antioxidant enzymes and ischemic tolerance as well as the inhibition of cell apoptosis and the modulation of neurotransmitters 36 39 Previously our group discovered that HBO preconditioning protected against MI and improved cardiac function 40 of which the underlying mechanisms were associated with the reduction of oxygen stress the correction of energy metabolism and the inhibition of apoptosis However the effect of HBO treatment on mitochondria and the interaction between mitochondrial dysfunction and autophagy remain unclear The present study aimed to investigate the effects of HBO treatment in a rat model of MIRI established by the ligation of the left anterior descending LAD artery through analyzing mitochondrial function and the mTOR mediated autophagy pathway Materials and methods Animal studies All animal experimental procedures were approved by the Animal Ethical Committee of Guangxi Medical University A total of 60 healthy Sprague Dawley rats of both sexes ratio 1 1 weight 180 220 g age 6 weeks were obtained from the Experimental Animal Centre of Guangxi Medical University Guangxi China Animals were housed a relative humidity of 60 10 with a 12 h light dark cycle Food and water were available ad libitum 4255 Experimental design and groupings According to previous guidelines 41 following 1 week of acclimatization to the laboratory conditions the 60 rats were divided into the following three groups 20 rats group using the random number table method i Sham group ii ischemia reperfusion IR group MIRI model and iii HBO group nary artery followed by reperfusion according to a previous sodium pentobarbital i p and mechanically ventilated using an animal respirator respiration rate 70 breaths min tidal volume 6 8 ml kg Shanghai Alcott Biotech Co Ltd The chest was then opened and the heart was exposed The LAD artery was ligated using a 5 0 silk suture for 30 min and released to allow reperfusion for 1 h Rats in the IR and HBO groups were subjected to a 30 min LAD ligation followed by reperfusion for 1 h whilst the sham group received encircling of the LAD artery with a suture but no ligation Before the surgical procedure rats in the HBO group were pretreated with HBO for 1 h 0 25 MPa for 14 days once daily in a hyperbaric chamber Yantai Hongyuan Co Ltd as previously described 38 At the end of the reperfusion all rats were immediately anesthetized using 30 mg kg sodium pentobarbital i p and were subsequently euthanized through exsanguination by collecting 8 ml blood from the abdominal aorta Death was when breathing had stopped Blood samples were centrifuged heart was promptly removed from the rats and the infarct was isolated on an ice box for further measurements Determination of ATP ADP AMP and cytochrome c levels in MI tissue Myocardial samples n 5 were homogenized in ice cold physiological saline 10 w v and centrifuged at and ADP levels were determined using ATP and ADP assay kits respectively colorimetric method cat nos ab83355 and ab83359 Abcam according to the manufacturer s protocols AMP and cytochrome c levels were determined using an AMP ELISA kit cat no tw045885 Shanghai Tongwei Biological Technology Co Ltd and a cytochrome c ELISA kit cat no ab210575 Abcam respectively and a SpectraMax Plus 384 microplate reader Molecular Devices LLC The EC was calculated using the following formula ATP 0 5 ADP ATP ADP AMP Measurement of intracellular ROS levels and opening of the mPTP Intracellular ROS and mPTP openings were detected using dihydroethidium DHE 10 M and calcein AM into 10 m sections using a Leica CM1950 frozen section machine Leica Microsystems GmbH According to the manufacturer s protocol sections were incubated with 10 M DHE cat no GMS10111 2 Genmed Scientific Inc and

Page 193

4256 MOLECULAR MEDICINE REPORTS 22 4254 4264 2020 Table I Primer sequences for reverse transcription quantitative PCR Gene NADH dehydrogenase subunit 1 Cytochrome c GAPDH Dynamin related protein 1 Mitofusin 1 Mitofusin 2 actin mTOR p53 GAPDH Primer sequence 5 3 F CGGCTCCTTCTCCCTACAA R ATGGTCCTGCGGCGTATT F CCCCTGCTATAACCCAATACA R CCAAACCCTGGAAGAATTAAGA F TGTTGCTGTAGCCATATTCATTGT R CCATTCTTCCACCTTTGATGCT F CGTAGTGGGAACTCAGAGCA R TGGACCAGCTGCAGAATAAG F GCTGCATACAGACAGACAGCCT R GGTAATGACCTGTCTCAGGGCT F GAACTTGTGTCTTGCATTTGGC R TGCAGGCCTAACTCCTCCCAC F CCTCTATGCCAACACAGTGC R ATACTCCTGCTTGCTGATCC F GTGTGGCAAGAGCGGCAGAC R TGTTGGCAGAGGATGGTCAAGTTG F GTCACCTCCACACCTCCACCTG R TGCCTGTCGTCCAGATACTCAGC F GGAGAAGGAGCAGGAGAATC R GAGACAGACAGGAGGTGATG F forward R reverse 0 1 mol l PBS solution Stained sections were visualized at was calculated using Image ProPlus version 6 0 software Media Cybernetics Inc Transmission electron microscopy Myocardial infarct tissue 1 mm3 and then blocked in 10 goat serum cat no 701323A Beijing Zhongsan Jinqiao Biotechnology Co Ltd for 15 min at room temperature Tissue sections were incubated with primary antibodies against 4E BP1 1 100 cat no ab131453 Abcam Atg5 1 100 cat no ab227084 Abcam and mTOR the primary incubation sections were incubated with a biotinylated goat anti rabbit immunoglobulin G secondary an increasing concentration ethanol series then embedded in streptavidin biotin complex 100 l per section for 15 min into 70 nm thick slices and stained with 3 uranium acetate Zhongsan Jinqiao Biotechnology Co Ltd for 20 min at room temperature The slides were subsequently stained with 3 3 diaminobenzidine for 15 min and 4E BP1 Atg5 and mTOR positive cells were observed under a light microscope magnification x200 Olympus Corporation In total five myocardial cells including the mitochondria intercalated discs myofilaments and autophagosomes were observed using a Hitachi H 7650 transmission electron microscope at magnifications of x15 000 and x30 000 Hitachi High Technologies Corporation and analyzed using RADIUS 2 0 EMSIS GmbH Immunohistochemistry of 4E BP1 Atg5and mTOR expression levels At the end of reperfusion myocardial tissue n 5 was digital camera Leica Microsystems GmbH Measurement of mtDNA copy number DNA was extracted from ischemic myocardial tissue using a mitochondrial DNA dehydration transparent dipped wax and embedding HSasDNA polymerase Takara Bio Inc and analysis were performed using a 7500 Real Time PCR system equipped with SDS software v2 0 Applied Biosystems Thermo Fisher Sections were incubated in 0 01 M sodium citrate buffer primer pairs were used for the PCR mtDNA 238 bp forward

Page 194

Page 195

Page 196

Page 197

Page 198

Page 199

4262 MOLECULAR MEDICINE REPORTS 22 4254 4264 2020 Authors contributions on Ser317 777 under the conditions of glucose starvation 65 The current study suggested that HBO pretreatment may inhibit MIRI induced autophagy through regulating the mTOR mediated autophagy pathway by increasing the expression levels of mTOR and 4E BP1and decreasing the expression levels of Atg5 and p53 Notably numerous studies have demonstrated that crosstalk between autophagy and apoptosis exists 66 67 Our previous study has demonstrated that the Bax family members caspase cascade and cardiomyocyte apoptosis were inhibited following HBO pretreatment 40 Thus these results suggested that the cardioprotective mechanism of HBO may be involved in inhibiting mTOR mediated autophagy Nonetheless the present study has numerous limitations It was observed that mitochondrial dysfunction and excessive autophagy occurred in the MIRI model following 30 min of ischemia and 1 h of reperfusion as evidenced by transmission electron microscopy immunohistochemistry and the been reported in numerous previous studies 20 21 68 69 In the present study HBO pretreatment was found to restore mitochondrial function and inhibit cardiomyocyte autophagy therefore it was hypothesized that the protective effect of HBO pretreatment may be related to the modulation of mitochondrial function and cell autophagy However the mechanism by which HBO pretreatment affects the cardiomyocyte mitochondria and autophagy remains to be further investigated Secondly several experimental methods were used to analyze the mitochondrial function including EC cytochrome c levels intracellular ROS production the opening of the mPTP mitochondrial ultrastructure mtDNA copy number and the mRNA expression levels of Drp 1 Mfn1 and Mfn2 In future experiments experimental methods investigating the bioenergetics and the status of oxidative phosphorylation will be used to further determine the mitochondrial function In conclusion the present study demonstrated that HBO pretreatment effectively protected rat hearts from MIRI This effect may be related to the restoration of mitochondrial function and the inhibition of cardiomyocyte autophagy Thus these for the mitigation of MIRI Acknowledgements The authors would like to thank Dr Jianquan Li from the Guangxi Medical University China for his technical support in immunohistochemistry Funding This present study was supported by the National Natural Science Foundation of China grant nos 81701089 and 81960246 The Guangxi Natural Science Foundation grant no 2017GXNSFBA198010 and the Guangxi Sanitation Research Project grant nos Z2016582 and Z20201096 Availability of data and materials The datasets used and or analyzed during the current study are available from the corresponding author on reasonable request WC and LL wrote the manuscript WC LL XC XP and CC performed the experiments ZN collected the data and analyzed the data CC designed the study revised the manuscript and funded the research All authors read and approved Ethics approval and consent to participate All animal experimental procedures were approved by the Animal Ethical Committee of Guangxi Medical University Patient consent for publication Not applicable Competing interests The authors declare that they have no competing interests References 1 Nabel EG and Braunwald E A tale of coronary artery disease and myocardial infarction N Engl J Med 366 54 63 2012 2 Writing Group Members Mozaffarian D Benjamin EJ Go AS 3 4 5 6 7 8 Despr s JP et al Executive summary Heart disease and stroke statistics 2016 update A report from the American Heart Association Circulation 133 447 454 2016 Buja LM Myocardial ischemia and reperfusion injury Cardiovasc Pathol 14 170 175 2005 Levisman J and Price MJ Update on the guidelines for the management of ST elevation myocardial infarction Am J Cardiol 115 Suppl 5 A3 A9 2015 Yellon DM and Hausenloy DJ Myocardial reperfusion injury N Engl J Med 357 1121 1135 2007 Ib ez B Heusch G Ovize M and Van de Werf F Evolving therapies for myocardial ischemia reperfusion injury J Am Coll Cardiol 65 1454 1471 2015 Lee MS Role of mitochondrial function in cell death and body metabolism Front Biosci Landmark Ed 21 1233 1244 2016 Shen YQ Guerra Librero A Fernandez Gil BI Florido J Garc a L pez S Martinez Ruiz L Mendivil Perez M Soto Mercado V Acu a Castroviejo Dario Ortega Arellano H et al Combination of melatonin and rapamycin for head and activation and activation of mitophagy and apoptosis via mitochondrial function regulation J Pineal Res 64 e12461 2017 9 Zhou H Hu SY Jin QH Shi C Zhang Y Zhu PJ Ma Q Tian F to the pathogenesis of cardiac microvasculature ischemia reperfusion injury via induction of mROS Mmediated cardiolipin opening J Am Heart Assoc 6 e005328 2017 10 Shires SE and Gustafsson AB Mitophagy and heart failure J Mol Med Berl 93 253 262 2015 11 Saito T and Sadoshima J Molecular mechanisms of mitochondrial autophagy mitophagy in the heart Circ Res 116 1477 1490 2015 12 Scarffe LA Stevens DA Dawson VL and Dawson TM Parkin 315 324 2014 13 Hausenloy DJ and Scorrano L Targeting cell death Clin Pharmacol Ther 82 370 373 2007 14 Liesa M Palacin M and Zorzano A Mitochondrial dynamics in mammalian health and disease Physiol Rev 89 799 845 2009 15 Ingerman E Perkins EM Marino M Mears JA McCaffery JM Hinshaw JE and Nunnari J Dnm1 forms spirals that are structurally tailored to fit mitochondria J Cell Biol 170 1021 1027 2005

Page 200

CHEN et al HYPERBARIC OXYGEN PROTECTS AGAINST MYOCARDIAL ISCHEMIA REPERFUSION INJURY 16 Smirnova E Griparic L Shurland DL and van der Bliek AM Dynamin related protein Drp1 is required for mitochondrial division in mammalian cells Mol Biol Cell 12 2245 2256 2001 17 Rapaport D Brunner M Neupert W and Westermann B Fzo1p is a mitochondrial outer membrane protein essential for the biogenesis of functional mitochondria in Saccharomyces cerevisiae J Biol Chem 273 20150 20155 1998 18 Santel A and Fuller MT Control of mitochondrial morphology by a human mitofusin J Cell Sci 114 867 874 2001 19 Hao M Zhu S Hu L Zhu H Wu X and Li Q Myocardial ischemic postconditioning promotes autophagy against ischemia 20 pathway Int J Mol Sci 18 614 2017 myocardial ischemia reperfusion injury in rats Drug Des Devel Ther 9 5933 5945 2015 21 Xuan F and Jian J Epigallocatechin gallate exerts protective effects against myocardial ischemia reperfusion injury through 2016 22 Hariharan N Zhai P and Sadoshima J Oxidative stress stimulates autophagic flux during ischemia reperfusion Antioxid Redox Signal 14 2179 2190 2011 23 regulates autophagy and apoptosis Cell Death Differ 18 571 580 2011 24 Mi N Zhao Y Liu ZH and Wan FY Termination of autophagy and reformation of lysosomes regulated by mTOR Nature 465 942 946 2010 25 Han YF Zhao YB Li J Li L Li YG Li SP and Li ZD Stat3 Atg5 signal axis inducing autophagy to alleviate hepatic ischemia reperfusion injury J Cell Biochem 119 3440 3450 2018 26 P pulo H Lopes JM and Soares P The mTOR signalling pathway in human cancer Int J Mol Sci 13 1886 1918 2012 27 translation in cancer metastasis and synaptic memory Control 28 2016 tumor suppression Proc Natl Acad Sci USA 109 9953 9958 2012 29 Tasdemir E Maiuri MC Galluzzi L Vitale I Djavaheri Mergny M D Amelio M Criollo A Morselli E Zhu C Harper F et al Regulation of autophagy by cytoplasmic p53 Nat Cell Biol 10 676 687 2008 30 Crighton D Wilkinson S O Prey J Syed N Smith P Harrison PR p53 induced modulator of autophagy is critical for apoptosis Cell 126 121 134 2006 31 Dekleva M Neskovic A Vlahovic A Putnikovic B Beleslin B and Ostojic M Adjunctive effect of hyperbaric oxygen treatment after thrombolysis on left ventricular function in patients with acute myocardial infarction Am Heart J 148 031 2004 32 Bennett MH Lehm JP and Jepson N Hyperbaric oxygen therapy for acute coronary syndrome Cochrane Database Syst Rev 7 CD004818 2015 33 Welch JL Cordell WH and Alonso RJ Hyperbaric oxygen therapy in acute ischemic stroke Results of the hyperbaric oxygen in acute ischemic stroke trial pilot study Stroke 34 571 574 2003 34 Liu WC Yang SN Wu CW Chen LW and Chan JY Hyperbaric oxygen therapy alleviates carbon monoxide poisoning induced delayed memory impairment by preserving brain derived neurotrophic factor dependent hippocampal neurogenesis Crit Care Med 44 e25 39 2016 35 dards and quality control in the practice of hyperbaric medicine Springer Switzerland Textbook of Hyperbaric Medicine pp 597 608 2016 36 Pan X Chen C Huang J Wei H and Fan Q Neuroprotective effect of combined therapy with hyperbaric oxygen and madopar on 6 hydroxydopamine induced Parkinson s disease in rats Neurosci Lett 600 220 225 2015 4263 37 Chen CX Fan QP Nong ZH Chen W Li YX Huang LY Feng DR Pan XR and Lan SY Hyperbaric oxygen attenuates withdrawal symptoms by regulating monoaminergic neurotransmitters and NO signaling pathway at nucleus accumbens in morphine dependent rats Neurochem Res 43 531 539 2018 38 Chen CX Huang LY Nong ZH Li YX Chen W Huang JP Pan XR Wu GW and Lin YZ Hyperbaric oxygen prevents cognitive impairments in mice induced by D galactose by improving cholinergic and anti apoptotic functions Neurochem Res 42 1240 1253 2017 39 Chen X Li Y Chen W Nong Z Huang J and Chen C Protective effect of hyperbaric oxygen on cognitive impairment induced by D galactose in mice Neurochem Res 41 3032 3041 2016 40 Chen C Chen W Nong Z Ma Y Qiu S and Wu G Cardioprotective effects of combined therapy with hyperbaric oxygen and diltiazem pretreatment on myocardial ischemia reperfusion injury in rats Cell Physiol Biochem 38 2015 2029 2016 41 B Davidson SM Deshwal S Devaux Y Lisa FD Sante MD et al Practical guidelines for rigor and reproducibility in preclinical and clinical studies on cardioprotection Basic Res Cardiol 113 018 0696 2018 42 sion data using real time quantitative PCR and the 2 Delta Delta C T method Methods 25 402 408 2001 43 Qiao X Jia S Ye J Fang X Zhang C Cao Y Xu C Zhao L Zhu Y Wang L and Zheng M PTPIP51 regulates mouse cardiac ischemia reperfusion through mediating the mitochondria SR junction Sci Rep 7 45379 2017 44 Cook SA Sugden PH and Clerk A Regulation of bcl 2 family proteins during development and in response to oxidative stress in cardiac myocytes Association with changes in mitochondrial membrane potential Circ Res 85 940 949 1999 45 Farber JL Mechanisms of cell injury by activated oxygen species Environ Health Perspect 10 Suppl 10 S17 S24 1994 46 of ischemia reperfusion injury Int Rev Cell Mol Biol 298 229 317 2012 47 Zorov DB Juhaszova M and Sollott SJ Mitochondrial reactive oxygen species ROS and ROS induced ROS release Physiol Rev 94 909 950 2014 48 Zhang T Zhang Y Cui MY Jin L Wang YM Lv FX Liu YL Zheng W Shang HB Zhang J et al mediating ischemia and oxidative stress induced myocardial necroptosis Nat Med 22 175 182 2016 49 Twig G Elorza A Molina AJA Mohamed H Wikstrom JD et al Fission and selective fusion govern mitochondrial segregation and elimination by autophagy EMBO J 27 433 446 2008 50 Brooks C Wei Q Cho SG and Dong Z Regulation of mitochondrial dynamics in acute kidney injury in cell culture and rodent models J Clin Invest 119 1275 1285 2009 51 Estaquier J and Arnoult D Inhibiting Drp1 mediated mitochonduring apoptosis Cell Death Differ 14 1086 1094 2007 52 Lander ES and Lodish H Mitochondrial diseases Gene mapping and gene therapy Cell 61 925 926 1990 53 Borst P and Grivell LA The mitochondrial genome of yeast Cell 15 705 723 1978 54 Haendeler J Dr se S B chner N Jakob S Altschmid J Goy C Spyridopoulos L Zeiher AM Brandt U and Dimmeler S Mitochondrial telomerase reverse transcriptase binds to and protects mitochondrial DNA and function from damage Arterioscler Thromb Vasc Biol 29 929 935 2009 55 Ong SB Subrayan S Lim SY Yellon DM Davidson SM and against ischemia reperfusion injury Circulation 121 2012 2022 2010 56 Ong SB Hall AR and Hausenloy DJ Mitochondrial dynamics in cardiovascular health and disease Antioxid Redox Signal 19 400 414 2013 57 and Li F YiQiFuMai powder injection attenuates coronary artery ligation induced heart failure through improving mitochondrial pathways Front Pharmacol 10 381 2019 58 Ma H Guo R Yu L Zhang Y and Ren J Aldehyde dehydrogenase 2 ALDH2 rescues myocardial ischaemia reperfusion injury Role of autophagy paradox and toxic aldehyde Eur Heart J 32 1025 1038 2011

Page 201

4264 MOLECULAR MEDICINE REPORTS 22 4254 4264 2020 59 Ma X Liu H Foyil SR Godar RJ Weinheimer CJ and Diwan A Autophagy is impaired in cardiac ischemia reperfusion injury Autophagy 8 1394 1396 2012 60 Dong W Yang R Yang J Ding J Wu H and Zhang J Resveratrol pretreatment protects rat hearts from ischemia reperfusion 61 62 63 Exp Pathol 8 8731 8741 2015 main gateway to autophagy Essays Biochem 61 565 584 2017 ular machinery and signaling regulation Curr Opin Cell Biol 22 124 131 2010 64 Hardie DG AMP activated SNF1 protein kinases Conserved guardians of cellular energy Nat Rev Mol Cell Biol 8 774 785 2007 65 regulate autophagy through direct phosphorylation of Ulk1 Nat Cell Biol 13 132 141 2011 66 Luo S and Rubinsztein DC Apoptosis blocks Beclin 1 dependent autophagosome synthesis An effect rescued by Bcl xL Cell Death Differ 17 268 277 2010 67 Yang B and Zhao S Polydatin regulates proliferation apoptosis and autophagy in multiple myeloma cells through mTOR p70s6k pathway Onco Targets Ther 10 935 944 2017 68 Liu CY Zhang YH Li RB Zhou LY An Tao Zhang RC Zhai M et al lncRNA CAIF inhibits autophagy and attenuates myocardial infarction by blocking p53 mediated myocardin transcription Nat Commun 9 29 2018 69 Guo X Jiang H Yang J Chen J Yang J Ding JW Li S Wu H and Ding HS Radioprotective 105 kDa protein attenuates ischemia reperfusion induced myocardial apoptosis and autophagy by inhibiting the activation of the TLR4 NF B signaling pathway in rats Int J Mol Med 38 885 893 2016 This work is licensed under a Creative Commons Attribution NonCommercial NoDerivatives 4 0 International CC BY NC ND 4 0 License

Page 202

Brit J Anaesth 1952 34 738 THE USE OF HYPERBARIC OXYGEN FOLLOWING CARDIAC ARREST BY A KOCH AND D M E VERMEULEN CRANCH Surgical University Clinic and Department of Anaesthesiology Wilhelmina Gasthuis Amsterdam Holland SUMMARY A case is described of cardiac arrest with resultant cerebral damage in a severely anaemic patient due to ballooning of the cuff of an endotracheal tube during the course of a 3 hour operation whereby an insidious occlusion of the left bronchus occurred The heart was restarted within 3 minutes Cerebral complications were treated with urea intravenously and to supply the brain with sufficient oxygen in spite of anaemia and oedema oxygen in the high pressure chamber Subjective and objective improvement during treatment in the chamber was very suggestive of an active contribution of this treatment towards total recovery Since the publication by Boerema et al in 1956 concerning a new field of research in surgery utilizing oxygen at a pressure of 3 atmospheres absolute many patients have been treated in this manner When a patient breathes oxygen at a pressure of 3 atmospheres absolute his plasma and all his tissues are drenched with oxygen in physical solution Boerema 1961 The oxygen in solution is sufficient for tissue requirements and little or no reduction of oxyhaemoglobin occurs Haemoglobin is superfluous Haldane 1895 Boerema et al 1959 It was thought that conditions in which a deficit of oxygen exists in some organs might be influenced favourably by this treatment Brummelkamp Hoogendijk and Boerema 1961 Illingworth et al 1961 The influence of hyperbaric oxygen drenching HOD was tried out therefore in an anaemic patient with severe brain damage and oedema caused by a cardiac arrest of 3 minutes duration CASE REPORT L J S 18123 a 51 year old man was admitted on September 6 1961 He had collapsed at his office For several days his stools had been black A year previously a duodenal ulcer had been diagnosed with a possible concomitant cholecystopathy With medical treatment his symptoms had not recurred until the melaena started In view of the situation of the ulcer which was dangerously near the bile duct and the patient s poor condition conservative treatment was carried out On September 8 in spite of the multiple blood transfusions the blood haemoglobin level was 50 per cent and the clinical condition was poor with repeated periods of pallor sweating and tachycardia and a systolic blood pressure between 115 and 145 mm Hg A Billroth II gastrectomy was therefore performed Premedication 0 5 mg atropine at 10 10 a m Induction 10 30 a m thialbarbitone and suxamethonium making use of the Sellick manoeuvre to prevent aspiration of blood from the stomach Maintenance nitrous oxide and oxygen 25 per cent using a Waters canister with leaking valve controlled ventilation of the lungs with d tubocurarine Blood pressure 130 60 mm Hg normal blood pressure was unknown Pulse rate 128 b p m at induction The 5th bottle of blood was dripping in during induction Towards the end of the operation nearly 3 hours after induction the anaesthetist became apprehensive because the pulse rate which had remained rapid in spite of transfusion of a further 5 bottles of blood during operation suddenly rose from 120 to 140 b p m and the blood pressure rose to 175 mm Hg The patient s colour was pale but not cyanotic There was no overfilling of jugular veins The endotracheal tube was clear A few minutes later when the abdomen was being closed the patient had a rapid bounding pulse which suddenly stopped a few seconds after the last wound suture had been laid There were no cardiac sounds at 13 32 hrs The thorax was opened in the 4th intercostal space as soon as cardiac arrest had been noticed The heart was seen as a dilated bag without any movement Cardiac massage was applied and 2 ml of adrenaline solution 1 1000 were injected into the right ventricle Before 13 35 hrs the heart was beating regularly and the systolic blood pressure was 160 mm Hg Ten minutes later the thorax was closed with a drain in the 7th intercostal space When the thorax was opened for the cardiac massage the left lung was seen to be collapsed and not moving in spite of insufflation Direct deflation of 738

Page 203

THE USE OF HYPERBARIC OXYGEN FOLLOWING CARDIAC ARREST endotracheal cuff allowed the left lung to expand normally The colour had remained pale but not cyanotic throughout The endotracheal cuff which had been tested by inflation and had appeared normal previous to insertion was as suspected found to be asymmetrically inflated on extraction and reinflation This bulge on the cuff which must have developed insidiously during the course of the operation had gradually blocked the left main bronchus Cyanosis was not apparent due to the low haemoglobin content of the blood in spite of numerous bottles of blood To improve his haemoglobin level which was still only 54 per cent he was given 300 ml of packed red cells Extra oxygen was supplied via a nasal catheter Antibiotic treatment consisted of three injections of 300 000 units of penicillin and 1 g of streptomycin per 24 hours At 16 00 hrs the patient opened his eyes when ordered to do so His pupils which had never been more than half dilated reacted to light He showed Babinski reflexes and there was some rigidity of the neck At this stage we considered using hyperbaric oxygen to supply the brain with more oxygen than it would normally obtain from anaemic blood We abstained however as our consultant neurologist could not yet exclude the possibility of a cerebral vascular accident as the cause of the symptoms since there had been a short period of high blood pressure 175 mm Hg which might have caused this It was now known that patient s normal systolic pressure was 125 mm Hg It was agreed to await events and to keep a urea solution ready for intravenous injection should more signs of cerebral oedema develop In the meantime another 300 ml of packed red cells were administered At 17 55 hrs there were attacks of convulsions and the head was continuously boring into the pillow There was no significant rise in temperature The urea solution equal portions of 60 per cent urea and 20 per cent invert sugar was run in rapidly 7 ml per minute When about 110 ml 40 g had thus been given there were signs of improvement There was less rigidity of the neck the legs were less spastic and he was making sounds No more urea was given The immediate effect of the urea infusion clinched the diagnosis of cerebral oedema In spite of packed red cell transfusions the haemoglobin level remained low 50 per cent and we decided therefore to use hyperbaric oxygen to improve the oxygen supply to the brain in the hope of thus preventing further damage to the brain The scheme of pressures against time read as follows Start 1 atm abs 19 38 hrs Pressure 20 metres 3 atm abs 19 49 Decompression to 6 metres 1 6 atm abs 20 49 At 6 metres 1 6 atm abs 21 04 At 3 metres 1 3 atm abs 21 08 At surface 1 atm abs 21 21 Tank temp 21 C This means that for 1 hour the patient who was breathing oxygen via a BLB mask obtained this oxygen at 2 atmospheres pressure above normal thereby saturating his body tissues with oxygen A point to note is that the oxygen mask was made of green rubber 739 The patient became conscious at 21 30 hrs On leaving the high pressure tank 8 hours after cardiac arrest and 4 hours after the urea administration the patient was able to pronounce simple words though with great difficulty The reflexes were tending towards normal Simple movements were performed on command The next morning he was very much better He said that he had great difficulty in arranging his thoughts but we considered this fairly complicated deduction as a good sign His speech was slurring and he used only short words and sentences He had a right sided hemianopsia Most striking was his rather querulous perseverance in telling everyone that the humidifying apparatus which we were using was the wrong apparatus He could not explain himself further than this He said he was sure that a machine of another colour was necessary to cure him At this time we were treating him with 10 ml of 10 per cent procaine in the glucose infusion in order to promote dilatation and better circulation in the cerebral vessels As we thought that this might be the cause of the unrest we stopped the procaine but he persisted in his complaint about using the wrong apparatus The blood haemoglobin level was now continuously above 70 per cent and therefore a repetition of the tank treatment was not considered necessary The next day two days after the operation dysarthria had disappeared and the patient was no longer querulous He now explained his complaint of the previous day Without any prompting or leading questions from us he told us that he remembered having the green mask on his face and consciously and rapidly feeling his head clearing He had even tried to say so when he was in the tank but owing to his dysarthria had not succeeded in making this clear at the time When he was treated the next day with the humidifying apparatus he had tried to convince us that the treatment in the tank with the green mask had done him more good Since he did not know about his cardiac arrest nor of the fact that he had been in the high pressure tank he had not been able to motivate his request for a machine of another colour At this time there was no longer any sign of hemianopsia on examination From that day on there was a rapid recovery The rectal temperature never rose above 38 C and the oculist s chart showed only a minimal defect in the right side of the field of vision As mishaps never occur singly we had the misfortune that the last inch of the thorax drain broke off on removal As this foreign body was still causing a slight but persistent ooze from the wound ten weeks after the operation we removed this piece of rubber on November 28 This small operation was performed under general anaesthesia without untoward effect In the meantime the patient has been out of the hospital since October 10 and has not had any complaints from either his head or his stomach DISCUSSION The most important observation in this case is the extremely suggestive effect both objective and subjective of the administration of oxygen in the hyperbaric oxygen chamber to this anaemic

Page 204

740 BRITISH JOURNAL OF ANAESTHESIA patient with cerebral oedema Although admittedly the urea which had previously been given probably had a hand in the recovery of this patient we are impressed by the speeding up of the process of recovery while the patient was under pressure We think that without this extra availability of oxygen the brain might have suffered irreparable damage since the blood was definitely not capable otherwise of carrying a sufficient amount of oxygen with the existing shortage of haemoglobin We are of the opinion that the urea infusion reduced the cerebral oedema and thus made it possible for more blood to enter the cerebral vessels This blood although short of haemoglobin nevertheless carried a sufficient amount of oxygen in physical solution thanks to the administration of oxygen in the chamber under three atmospheres of pressure ACKNOWLEDGMENT We wish to express our thanks to the consulting neurologist Dr L van Trotsenburg for her important activities in the treatment of this patient REFERENCES Boerema 1 1961 An operation room with high atmospheric pressure Surgery 49 291 Kroll J A Meyne N G Lokin E Kroon B and Huiskes J W 1956 High atmospheric pressure as an aid to cardiac surgery Arch chir need 8 193 Meyne N G Brummelkamp W H Bouma S Mensch M H Kamermans F Stern Hanf M and Van Aalderen W 1959 Life without blood Arch chir need 11 70 Brummelkamp W H Hoogendijk J and Boerema I 1961 Treatment of anaerobic infections clostridial myositis by drenching the tissues with oxygen under high atmospheric pressure Surgery 49 299 Haldane J S 1895 The relation of the action of carbonic oxide to oxygen tension J Physiol 18 Illingworth C F W Smith G Lawson D D Ledingham I McA Sharp G R Griffiths J E and Henderson C I 1961 Surgical and physical observations in an experimental pressure chamber Brit J Surg 49 214 222 SOMMAIRE Description d un cas d arret du coeur ayant pour consequence des ldsions ce ebrales chez un patient tres an anemid par suite de la mise en ballon de la manchette d un tube endo trache al au cours d une operation ayant dur trois heures Pendant cette intervention il se produisit une occlusion insidieuse de la bronche gauche Le coeur fut remis en marche en moins de trois minutes Les complications celebrates furent trait es par de l uree intraveineuse et pour fournir au cerveau une quantite suffisante d oxygene malgre son anemic et son oedeme par de l oxygene administre e dans la chambre a haute pression L ameiioration subjective et objective deja pendant le traitement dans la chambre a surpression suggere tres fortement que ce traitement a contribue activement a la guerison complete et totale ZUSAMMENFASSUNG Ein fall von Herzstillstand mit anschliessender Hirnschadigung bei einem schwer anamischen Patienten als Folge eines Ballon artigen Auftreibens der Manschette eines endotrachealen Katheters wird beschrieben bei dem ein langsamer Verschluss des linken Bronchus entstand Innerhalb von 3 Minuten wurde die Herztatigkeit wieder in Gang gesetzt Die Hirnkomplikationen wurden mit intravenoser Gabe von Harnstoff und zur Versorgung des Hirns mit geniigend Sauerstoff trotz Anamie und Oedem mit Sauerstoff in der Ueberdruck Kammer behandelt Die subjektive und objektive Besserung in dieser Kammer sprach deutlich fur einem aktiven Beitrag dieser Behandlung zur vollsandigen Wiederherstellung

Page 205

Anaesth Intensive Care 2010 38 175 184 Hyperbaric oxygen therapy in the treatment of post cardiac surgical strokes a case series and review of the literature A J GIBSON F M DAVIS Hyperbaric Medicine Unit Christchurch Hospital Christchurch New Zealand SUMMARY Strokes remain an uncommon but significant complication of cardiac surgery Cerebral air embolism is the likely aetiology in the majority of cases Hyperbaric oxygen therapy is the recognised treatment for cerebral air embolism associated with compressed air SCUBA diving accidents and is therefore also the standard of care for iatrogenic causes of air embolism It follows that there is a logic in treating post cardiac surgical stroke patients with hyperbaric oxygen The aim of this retrospective review was to examine the outcomes of 12 such patients treated in the Christchurch Hospital hyperbaric unit and to appraise the evidence base for the use of hyperbaric oxygen therapy in this setting Despite delays of up to 48 hours following surgery before the institution of hyperbaric oxygen therapy 10 of the 12 patients made a full neurological recovery or were left with mild residual symptoms with nine returning to their previous level of care One patient remained hemiplegic and there was one early neurological death There is a paucity of prospective data in this area but based on sound pathophysiological principles and clinical experience we believe that patients suffering a stroke following open cardiac surgery should be considered for hyperbaric oxygen therapy Key Words hyperbaric oxygen therapy cerebral ischaemia cardiac surgery air embolism Numerous cardiac surgical procedures are performed every year and many patients suffer neurological sequelae in the postoperative period Studies1 3 suggest about 2 of patients will suffer a major stroke the effects of which on morbidity and mortality have been well described In hospital postoperative mortality is increased from less than 4 to approximately 20 in patients who suffer a stroke and length of hospital stay is prolonged with a greater proportion of these patients being discharged to long term care facilities rather than to an independent existence at home4 Long term mortality remains excessive compared to non stroke patients4 This paper reviews a series of 12 patients with post cardiac surgical stroke in one centre between 1993 and 2006 who were treated with hyperbaric oxygen therapy HBOT and examines the rationale behind the use of HBOT in this condition METHODS Between 1993 and 2006 12 patients with postcardiac surgical stroke were treated with hyperbaric oxygen in the Christchurch Hospital hyperbaric facility Data were collected from a retrospective review of the hospital medical and hyperbaric unit records The main outcome measures were survival neurological outcome and the type of discharge facility to which the patients were sent Follow up information was obtained from the medical records and telephone contact with the patients where possible M B Ch B F A N Z C A F J F I C M Medical Officer Hyperbaric Medicine Unit and Specialist Department of Intensive Care Medicine M A F R C A F A N Z C A M D Medical Director and postoperatively he remained with a diminished Glasgow Coma Score of 11 15 and also had a dense left hemiplegia He was transferred to the Christchurch Hospital hyperbaric facility the following day for HBOT Address for correspondence Dr A J Gibson Department Intensive Care Medicine Christchurch Hospital Private Bag Christchurch New Zealand Accepted for publication on July 6 2009 Anaesthesia and Intensive Care Vol 38 No 1 January 2010 Patients Case 1 A 55 year old man undergoing an aortic valve replacement AVR had spontaneous return of cardiac activity following release of the aortic clamp and before air could be evacuated from the left ventricle Blanching was noted over the distribution of the right temporal artery and the heart then

Page 206

176 A J GIBSON F M DAVIS Royal Navy treatment table 62 RN62 he had some improvement in his left sided weakness but it was also apparent that he had some right sided weakness He was able to be extubated at this stage and went on to have three further daily 18 60 30 treatments during which time he continued to improve When assessed one week later prior to his referral back to his home team he had made a complete neurological recovery Case 2 A 72 year old woman underwent an AVR with no apparent intraoperative problems However postoperatively she failed to regain consciousness and had a left sided hemiparesis A computed tomography CT scan demonstrated a watershed pattern infarction of the right middle and posterior cerebral artery territories She was kept intubated and transferred one day postoperatively to Christchurch Hospital for HBOT followed up with four daily 18 60 30 treatments She was extubated after the second treatment and by the end of the treatment course was fully conscious and with minimal left sided weakness This had completely resolved when assessed two weeks later Case 3 A 53 year old woman with mixed mitral valve disease and moderate aortic prosthetic incompetence from an AVR 20 years previously underwent a mitral valve replacement MVR and aorta The procedure was complicated by puncture of the carotid artery when cannulation of the right internal jugular vein was attempted The day following surgery she had failed to regain consciousness had extensor posturing in her limbs and diminished left sided motor responses She underwent one RN62 treatment 20 hours following surgery with no apparent improvement in her responses A CT scan showed an extensive right middle cerebral artery territory infarction with 8 mm of midline shift as well as infarctions in the cerebellar and pontine regions Echocardiography excluded any left ventricular thrombus A few hours after her HBOT she developed an enlarged unresponsive right pupil accompanied by a hypertensive response which failed to respond to intracranial pressure control measures and she died later that day Case 4 A 53 year old man had a MVR and annuloplasty with no apparent intraoperative problems However postoperatively it was clear that he had a dense left hemiplegia A RN62 treatment was commenced within four hours of the end of surgery followed by two daily Royal Navy table 61 RN61 treatments A CT scan showed a single area of oedema or infarction of the watershed territories of the right middle and anterior cerebral arteries which at the time led to the suggestion that air embolism was not likely to be the cause As he had not demonstrated any dramatic improvement by day three no further HBOT was undertaken At surgical follow up at six weeks he had made a complete neurological recovery Case 5 A 63 year old woman had an uneventful AVR Upon wakening she had an obvious left sided hemiparesis affecting her arm to a greater extent than her leg She was not referred to the hyperbaric service until her second postoperative day with no change in her condition at that time She underwent a RN61 HBOT and this was repeated the improvement in her symptoms She went on to complete six further daily treatments each of 14 90 30 and at the end of this treatment course she had minimal weakness in her left shoulder and elbow only Case 6 A 74 year old man underwent a Bentall s procedure with no obvious problems His recovery was complicated by a left hemiplegia which became apparent upon wakening He was referred to the hyperbaric service and underwent an extended RN62 which was initiated four hours following the end of his surgery Following this treatment he had some return of function in his hand and foot Over the next four days he received daily table 18 60 30 treatments during which time he made steady improvement By the end of the treatment course he was able to walk unassisted and had minimal weakness in his left arm and leg Case 7 A 69 year old woman had an off pump coronary artery bypass procedure However during the procedure a tear occurred in the ascending aorta necessitating a repair on cardiopulmonary bypass When assessed postoperatively while still intubated she had no movement in either leg or in Anaesthesia and Intensive Care Vol 38 No 1 January 2010

Page 207

HBOT THERAPY IN THE TREATMENT OF POST CARDIAC SURGICAL STROKES her right arm Her level of consciousness remained diminished She was transferred to the hyperbaric unit and underwent a RN62 HBOT Following this treatment she had an improved level of consciousness and was moving her left arm and leg The following day she had a 18 60 30 treatment and was then able to be extubated There was some return of function in her right arm and leg however no further HBOT was offered as she was known to have bilateral carotid artery stenosis and an ischaemic cerebrovascular accident was thought the more likely diagnosis However she continued to improve such that by the time she left hospital she was largely independent and walking with a gutter frame Case 8 A 77 year old man had an AVR and mitral valve repair which appeared to go uneventfully He was slow to wake postoperatively and once able to be assessed he had an obvious left hemiparesis He was kept intubated and transferred for HBOT Ten hours after the end of his surgery he was commenced on a RN62 The next day there was no HBOT was offered A CT scan showed a low density lesion in the right fronto parietal region consistent with ischaemia and low density white matter change consistent with small vessel disease However his symptoms continued to improve such that he was able to leave hospital one week following his surgery with normal power in his left arm and minimal weakness in the leg Case 9 One day following this 65 year old man s uneventful MVR and closure of a patent foramen ovale he remained confused and with left sided weakness and neglect He underwent a RN62 HBOT some 24 hours following his surgery The following day he had one further 14 90 30 Following his treatment course he demonstrated some improvement and by the time he was seen for his six week surgical follow up his symptoms and signs had completely resolved Case 10 A 77 year old woman had a combined AVR and coronary artery bypass procedure At surgery some intravascular air was noted at the time of regrafting one of the vessels Postoperatively she was slow to wake and had a dense left hemiplegia The following morning she was extubated but required reintubation due to a marginal airway Anaesthesia and Intensive Care Vol 38 No 1 January 2010 177 and raised arterial carbon dioxide She was then transferred for HBOT which commenced 24 hours following her surgery A RN62 was followed by extubation and then three daily 18 60 30 HBOT However the last treatment was abandoned after 30 minutes due to claustrophobia and agitation She was much improved by the end of the treatment course Her limbs were of normal strength but there was mild facial asymmetry and mild short term Case 11 A 79 year old woman was slow to wake following an uneventful AVR and coronary artery bypass procedure She appeared agitated and had a dense left hemiplegia Preoperative carotid ultrasound had excluded any carotid disease and despite the absence of any intraoperative concerns she was offered HBOT Some 18 hours following her surgery she underwent a RN62 HBOT while still intubated The following day she had one further 18 60 30 HBOT At this stage there had been no obvious response and no further HBOT was offered She was then extubated and her postoperative course was further complicated by a chest infection and congestive heart failure By the time she was transferred to another hospital for rehabilitation she had made a complete recovery from her hemiplegia However she was then transferred back to the cardiological team after another two weeks with cardiogenic shock to which she succumbed Case 12 A 67 year old woman had a MVR and tricuspid valve repair during which a rush of air was noted from the aortic root needle Postoperatively she had a diminished level of consciousness with a dense left hemiplegia and left sided neglect She was kept intubated to facilitate HBOT Some 12 hours following her surgery she received a RN62 treatment followed by two further daily treatments one RN61 and one 18 60 30 Her level of consciousness had improved after the second treatment such that she was able to be extubated but there was minimal improvement in her hemiplegia A CT scan on day two following her surgery showed extensive areas of oedema and infarction throughout the right cerebral hemisphere consistent with a watershed type of infarction plus some focal areas of haemorrhagic transformation At follow up she had improved to some degree but had residual left sided hemiparesis such that she could only walk with the aid of a stick

Page 208

178 A J GIBSON F M DAVIS Patient summary series with an average age of 67 years range 53 to 79 years All patients had undergone an openheart procedure with 11 of the 12 receiving a valve replacement and the 12th a coronary artery bypass graft complicated by a tear to the ascending aorta which required repair In only four of the 12 cases was there any clinical suspicion of an air embolism event at the time of surgery The most common presentation was delayed or incomplete recovery in the intensive care unit plus focal neurological signs of a stroke which in all cases affected the patient s left side HBOT was approximately 18 hours range 4 to 48 hours This delay was due to the inherent recovering from anaesthesia or an initial failure to consider the diagnosis As well three patients were transferred from another centre The HBOT was carried out in the Christchurch Hospital multiplace hyperbaric facility with trained in all cases by bilateral myringotomies performed by an ear nose and throat surgeon to prevent aural barotrauma The mean number of HBOTs per patient was three range one to three The initial HBOT was usually a RN62 lasting a total of 4 75 hours initially at a pressure of 2 8 ATA and then reduced to 1 9 ATA which is the standard treatment used for the initial presentation of cerebral arterial gas embolism CAGE related to self contained underwater breathing apparatus SCUBA diving accidents Patients who presented later than 24 hours usually received a shorter to RN62 but for only 2 25 hours Follow up treatments were usually treatment table 18 60 30 or 18 90 30 60 or 90 minutes respectively at 2 8 ATA followed by a 30 minute decompression The choice of treatment table was usually a and the clinical state of the patient Treatment courses were stopped once the patient recovered or died or when no further improvement was seen after two sequential treatments The HBOT was generally well tolerated with no complication in any of the patients attributable was abandoned after 30 minutes of the scheduled 90 minutes because of agitation due to claustrophobia RESULTS By the end of the HBOT course there was a partial or complete resolution of neurological symptoms and signs in eight of the 12 patients Three patients demonstrated minimal neurological improvement and one further patient who received a single HBOT died a rapid neurological death had fully recovered and four had minimal residual symptoms One patient remained hemiplegic but mobile and one patient had made a full neurological recovery but died a cardiological death one month following her surgery In total nine of the 10 surviving patients were able to return to their home or previous level of care DISCUSSION Risk factors for post cardiac surgical strokes for the development of post cardiac surgical strokes2 3 5 8 Patient factors include age hypertension diabetes and history of a previous stroke As well there is some evidence that coronary artery bypass procedures performed without cardiopulmonary bypass are associated with a lower incidence of strokes9 12 or new cerebral ischaemic lesions on magnetic resonance imaging MRI scanning13 compared with those procedures performed on apparent it is also clear that open procedures such as valve replacements where the left ventricle is opened are associated with an increased risk compared to coronary artery bypass procedures2 4 6 7 This has implications when considering the pathophysiology of strokes in this context Theroretical mechanisms for the development of postcardiac surgical strokes Several mechanisms have been proposed to explain the development of postoperative strokes in the setting of cardiac surgery These are 1 Solid particulate matter from the bypass circuit or atheromatous plaque fragments dislodged from the aorta during cross clamping 2 A decrease in cerebral perfusion pressure during the perioperative period 3 Gaseous emboli which enter the arterial circulation from the bypass circuit or while the cardiac chambers are open to the atmosphere Attempts have been made to relate the CT or MRI appearances of the lesion to the presumed mechanism of injury2 4 For instance solid particulate emboli are likely to cause a single cerebral artery Anaesthesia and Intensive Care Vol 38 No 1 January 2010

Page 209

HBOT THERAPY IN THE TREATMENT OF POST CARDIAC SURGICAL STROKES territory infarction A decrease in cerebral perfusion pressure is more likely to affect the watershed territory between adjacent vessels and gaseous emboli should give multiple lesions affecting more than one vessel territory However in the case of apparent single lesions 179 not exclude CAGE as a cause obstruction to blood flow if the air bubble is large enough to occupy several generations of branching arterioles such that the net surface tension pressure acting on the column exceeds the cerebral perfusion pressure20 endothelial damage from the passage of bubbles and an inflammatory response which initiates a sequence of events characterised by endothelial swelling and increased vascular resistance leucocyte and platelet adherence and damage to the blood brain barrier leading to cerebral oedema and neuronal apoptosis Although air can be detected in all patients undergoing cardiopulmonary bypass the vast the causes of stroke in this context found that the majority were due to emboli2 4 One such study14 the exception of those rare cases where there are technical problems associated with bypass the to identify the aetiology of post cardiac surgical procedures in which the left ventricle or aorta are opened such as valve replacement surgery All of the patients in this series had undergone such procedures and indeed the decision to treat with HBOT or not was to a large extent determined by the nature of the operation the patient had received detailed or repeat examinations2 6 In the case of watershed infarcts a combination of multiple gaseous emboli and low perfusion pressure is more likely to result in injury than either factor in isolation8 Thus the scan appearances of a patient with a post cardiac concluded that emboli accounted for 62 of cases with an additional 19 being due to multiple aetiology or hypoperfusion and 13 having an unknown aetiology In addition a study looking at new postoperative lesions on MRI scans found that the majority were ischaemic injuries caused by intraoperative emboli15 Interestingly all the patients in this current series had left sided symptoms with two patients also having right sided weakness This is not surprising given the anatomy of the aortic arch which would favour air passing preferentially up the right carotid artery with a resultant right hemispheric lesion and left hemiparetic symptoms and signs This propensity to left sided symptomatology has been reported previously16 Doppler studies undertaken during cardiac heart valve procedures demonstrate echogenic particles during all such operations17 Their numbers peak at certain points of the procedure such as aortic cross clamping and unclamping and when the heart starts to eject The incidence of postoperative with the intraoperative echo count2 7 18 It is likely therefore that embolic phenomena are a major contributor to these lesions What cannot be discerned either radiologically or from the echo count of conventional transcranial Doppler is the nature of the emboli that is whether they represent gas bubbles or solid particulate matter but air emboli are thought to be likely in the majority of cases6 19 The mechanisms of injury by gaseous emboli include Anaesthesia and Intensive Care Vol 38 No 1 January 2010 Iatrogenic CAGE its diagnosis and the role of neuroimaging Air or gas may enter the circulation during many invasive medical and surgical interventions21 23 Air entering the venous system usually causes pulmonary symptoms as the air bubbles embolise to the lungs HBOT is not indicated for venous air embolism However a large volume of air in mechanism of the lungs and thereby traverse across to the arterial circulation As well approximately 30 of the population have a potentially patent foramen ovale which allows right to left shunting of air bubbles Air or other gases in the arterial circulation from these mechanisms or directly into the pulmonary veins or systemic arteries may embolise to the central nervous system and cause symptoms such as confusion decreased level of consciousness coma seizures and focal neurological changes The diagnosis of CAGE is usually situational whereby an acute change in the neurological status of the patient is seen in the context of a procedure where air embolism could have occurred21 Other clinical signs that may be seen include mydriasis air in the retinal arteries and marbling or irregular pallor of the skin or mucous membranes Most centres report CT or MRI scanning as less than helpful except in individual cases where

Page 210

180 A J GIBSON F M DAVIS other pathologies such as haemorrhage are being excluded23 27 exclude CAGE as the diagnosis and may lead to excessive delays in treatment23 Our case series reinforces the suggestion25 28 that as with other high risk procedures postcardiac surgical patients who are slow to regain consciousness and have evidence of focal neurological signs in the absence of other known potential causes should be considered as having a diagnosis of CAGE Conventional treatment of intraoperative air embolism Avoidance of embolic injury involves attention to surgical technique such as avoidance of crossclamping atheromatous regions of the aorta and meticulous de airing When embolisation has been observed treatment has generally included patient positioning supine evacuation of air 100 oxygen retrograde perfusion optimisation of cerebral blood flow supportive measures such as positive pressure ventilation and vasopressors and some centres advocate moderate hypothermia and or steroids but the latter is certainly not recommended Ongoing supportive care includes control of seizure activity and consideration of the use of a lignocaine infusion for 48 hours postoperatively This has been shown in a prospective randomised clinical trial to have a neuro protective effect during cardiac surgery20 None of the patients in this current series had received lignocaine but its use would be considered in future cases Other neuroprotective agents such as beta blockers and aspirin have also been effective in animal models Of interest is that all of these agents have anti29 30 Hyperbaric oxygen therapy HBOT is the intermittent use of a partial pressure of oxygen above atmospheric pressure for the treatment of disease There are a number of recognised indications including CAGE associated with compressed air diving accidents Experimental studies and extensive clinical experience over many years from civil engineering operations military and sports diving has established HBOT as the reduction in bubble size as a function of the pressure Boyle s law 21 31 increased rate of bubble resolution by enhancing the nitrogen diffusion gradient31 32 increased oxygen delivery to ischaemic tissues25 a reduction in intracranial pressure due to vasoconstriction21 decreased cerebral oedema25 and decreased leucocyte activation and adhesion to damaged endothelium which limits the inflammatory response and reperfusion injury33 35 HBOT and iatrogenic CAGE In common with the pathophysiology of CAGE related to compressed air diving CAGE due to invasive medical procedures and surgery should logically also be treated with HBOT Iatrogenic CAGE is a rare complication of many invasive procedures that are undertaken in many different medical disciplines36 It is for this reason that the CAGE is unlikely to ever be subjected to a prospective randomised clinical trial The precise incidence is unknown and likely underestimated simply undiagnosed The recognition and treatment of iatrogenic CAGE has lagged far behind medical knowledge37 designed to enhance the dissolution of bubbles in the intravascular space32 and it can be argued that prospective randomised studies are not required to demonstrate simple physical principles Air bubbles can remain in the intravascular space for more than 48 hours after embolism38 with larger bubbles which are more likely to be symptomatic taking the longest time to resolve19 There exists a considerable body of human case reports case series and animal studies starting with Bert in 1868 showing that HBOT improves survival and functional brain recovery and on this basis HBOT cases of iatrogenic CAGE22 26 39 40 There is one important difference in the pathophysiology of iatrogenic CAGE ompared to that associated with diving accidents SCUBA divers who suffer CAGE will also have accumulated a nitrogen load in their tissues because of breathing air at increased ambient pressure for the duration HBOT treatment regimen used to treat divers is initial HBOT treatment for divers with CAGE effects of HBOT in CAGE are Anaesthesia and Intensive Care Vol 38 No 1 January 2010

Page 211

HBOT THERAPY IN THE TREATMENT OF POST CARDIAC SURGICAL STROKES theory a much shorter treatment schedule for iatrogenic CAGE may be all that is required and many of the case reports and series had successful outcomes with shorter HBOT treatment schedules Many different HBOT regimens have been used31 41 44 and further studies of the appropriate The natural history of CAGE post cardiac surgery without HBOT A study dating back over 40 years found an approximate mortality of 90 for untreated iatrogenic CAGE This was reduced to 33 with conventional supportive treatment45 46 in the context of adverse neurological outcomes following cardiac surgery two large studies have looked prospectively at this group Salazar et al4 reported on 5971 consecutive patients and found day The incidence was higher in valve replacement patients versus coronary artery bypass patients The occurrence of stroke was associated with an increased intensive care and hospital length of stay increased hospital mortality 19 vs 4 an increased chance of discharge to long term rehabilitation or nursing care environment and reduced long term survival Roach et al1 looked at 2108 cardiac patients of whom 6 1 had adverse cerebral outcomes most of which were strokes These were also associated with increased length of stay mortality and likelihood of discharge to long term care facilities Thus mortality and morbidity remains excessive in post cardiac surgical strokes and the most likely aetiology is iatrogenic CAGE What is the evidence that HBOT improves outcome in iatrogenic CAGE Retrospective studies and case series A study of nine patients47 with haemodialysisassociated CAGE who received conventional treatment demonstrated little improvement Once HBOT was instituted there was dramatic improvement within 10 minutes in seven of the patients and with resolution in the other two patients following an extended HBOT treatment regimen Another series of 30 patients48 found near or complete resolution of symptoms following HBOT in 24 of the patients while only two died A retrospective study of all iatrogenic CAGE patients admitted to a unit in Marseille between 1980 and 199940 divided their group of 86 patients into venous causes of CAGE 63 patients and arterial Anaesthesia and Intensive Care Vol 38 No 1 January 2010 181 causes 23 patients Outcomes were described as total recovery in 50 58 of patients longterm neurological sequelae in 29 34 cases and mortality in seven 8 cases In the larger venous group treatment with HBOT was clearly associated with better outcomes if given early rather than delayed Another study of 16 patients21 also found improved outcomes with HBOT especially if given within six hours of injury In a case series of patients who had an in hospital ischaemic stroke within four hours of a procedure with a high risk of CAGE37 six patients who received HBOT were compared with a historical group of 15 patients who did not The mortality in the HBOT group was zero compared to 13 in the controls and neurological outcomes were much more favourable in that all patients not receiving HBOT were discharged into long term care while the HBOT group were independent at home a review of the experience of the facility at the Israeli Naval Medical Institute between 1985 and 199822 were treated with HBOT Full recovery occurred in and three died 18 mortality In this group the diagnosis of CAGE was made by the surgical team who then initiated conventional treatment before deciding whether to refer for HBOT or not Referral was therefore often relatively late and they also delay and outcome in this series Prospective studies There is a sound theoretical basis and reasonable clinical experience to support the use of adjunctive HBOT in post cardiac surgery strokes to improve clinical outcomes There are no prospective data to support such a claim What harm could treating with HBOT do The potential side effects or complications of HBOT are well recognised and include the following The difficulty of managing a complicated postoperative patient in an HBU environment Barotrauma pulmonary middle ear Oxygen toxicity cerebral pulmonary Claustrophobia

Page 212

182 A J GIBSON F M DAVIS In a well managed hyperbaric facility these potential problems have a very low incidence and generally with no long term consequences of CAGE as the cause of a particular cerebral insult following cardiac surgery it is important to consider the potential effect on outcome of HBOT given to a patient who has a stroke due to non CAGE related pathology A recent systematic review49 addressed the use of HBOT in the acute presentation of ischaemic strokes The reviewer cautioned that oxygen delivery reduced cerebral oedema and the inhibition of leucocyte activation must be considered alongside the potential toxicity of increased oxygen free radical species generated in a high oxygen dose environment A detailed analysis of the data 42 44 with reasonably robust methodology totalling 106 patients and found no convincing evidence that HBOT improved outcome when applied during the acute presentation of ischaemic strokes However this conclusion has been questioned by one of the Cochrane reviewers as there was a wide range of oxygen doses across of the HBOT in many cases A recent preliminary single blinded controlled trial50 compared 18 patients with lacunar infarcts and periventricular hypodensity on CT scan treated with daily HBOT for 10 days with a control group of eight patients who received sham HBOT Neurological outcomes were improved in the HBOT group at six months follow up compared to the control group Overall there is no clear signal as to whether HBOT in the CONCLUSIONS Iatrogenic CAGE is a rare complication of invasive medical procedures across many medical disciplines Clinical experience suggests that HBOT confers improved outcomes for patients Strokes following cardiac surgery remain a serious problem for patients and healthcare providers alike It is likely that iatrogenic CAGE is an important factor in the pathogenesis of this condition There is a sound theoretical basis for advocating the use of HBOT in post cardiac surgical strokes which is supported by a number of case series These series reported improved outcomes We have presented a series of 12 such patients treated in one centre of whom 10 had a good neurological outcome Prospective studies are lacking Whether prospective studies on humans can ever be justified in this condition is debatable It is disappointing that while many authors recognise that iatrogenic CAGE from any cause is relatively uncommon and under recognised despite basic physiological principles they advocate only general supportive measures until the efficacy of treatment with HBOT is proven16 51 With the present state of knowledge HBOT remains the definitive treatment for strokes associated with cardiac bypass surgery Indeed it is the only therapeutic option apart from general supportive measures and is a treatment modality associated with minimal morbidity However prospective studies would be useful in establishing the optimum therapeutic regimen and perhaps the length of delay before HBOT is no longer of benefit As a treatment modality HBOT is low risk in a properly managed hyperbaric facility However as with all such clinical dilemmas the risks of transferring potentially unstable postoperative patients must be weighed against the potential benefits in each individual case We would propose that any patient known to have suffered an intraoperative air embolism and or is slow to recover from a cardiac bypass procedure and who demonstrates focal neurological signs should be considered for hyperbaric oxygen therapy REFERENCES 1 Roach GW Kanchuger M Mangano CM Newman M Nussmeier N Wolman R et al Adverse cerebral outcomes after coronary bypass surgery Multicenter Study of Perioperative Ischemia Research Group and the Ischemia Research and Education Foundation Investigators N Engl J Med 1996 335 1857 1863 2 Wityk RJ Goldsborough MA Hillis A Beauchamp N Barker PB Borowicz LM Jr et al Diffusion and perfusion weighted brain magnetic resonance imaging in patients with neurologic complications after cardiac surgery Arch Neurol 2001 58 571576 3 McKhann GM Grega MA Borowicz Jr LM Selnes OA Baumgartner WA Royall RM Encephalopathy and stroke after coronary artery bypass grafting Curr Treat Options Cardiovasc Med 2004 6 171 178 4 Salazar JD Wityk RJ Grega MA Borowicz LM Doty JR Petrofski JA et al Stroke after cardiac surgery short and longterm outcome Ann Thorac Surg 2001 72 1195 1201 discussion 1201 1202 5 Ascione R Reeves BC Chamberlain MH Ghosh AK Lim KHH Angelini GD Predictors of stroke in the modern era of coronary artery bypass grafting a case control study Ann Thorac Surg 2002 74 474 480 6 Caplan L Protecting the brains of patients after heart surgery Arch Neurol 2001 58 549 550 Anaesthesia and Intensive Care Vol 38 No 1 January 2010

Page 213

HBOT THERAPY IN THE TREATMENT OF POST CARDIAC SURGICAL STROKES 7 Arrowsmith JE Grocott HP Reves JG Newman MF Central nervous system complications of cardiac surgery BJA 2000 84 378 393 8 Barbut D Hinton RB Szatrowski TP Hartman GS Bruefach M Williams Russo P et al Cerebral emboli detected during bypass surgery are associated with clamp removal Stroke 1994 25 2398 2402 9 Karthik S Musleh G Grayson AD Keenan DJM Pullan DM Dihmis WC et al Coronary surgery in patients with peripheral vascular disease effect of avoiding cardiopulmonary bypass Ann Thorac Surg 2004 77 1245 1249 10 Patel NC Deodhar AP Grayson AD Pullan DM Keenan DJ Hasan R et al Neurological outcomes in coronary surgery independent effect of avoiding cardiopulmonary bypass Ann Thorac Surg 2002 74 400 405 discussion 405 406 11 Stamou SC Jablonski KA Pfister AJ Hill PC Dullum MKC Bafi AS et al Stroke after conventional versus minimally invasive coronary artery bypass Ann Thorac Surg 2002 74 394399 12 Zamvar V Williams D Hall J Payne N Cann C Young K et al Assessment of neurocognitive impairment after off pump and on pump techniques for coronary artery bypass graft surgery prospective randomised controlled trial BMJ 2002 325 1268 13 Lund C Sundet K Tennoe B Hol PK Rein KA Fosse E et al Cerebral ischemic injury and cognitive impairment after offpump and on pump coronary artery bypass grafting surgery Ann Thorac Surg 2005 80 2126 2131 14 Likosky DS Marrin CAS Caplan LR Baribeau YR Morton JR Weintraub RM et al Determination of etiologic mechanisms of strokes secondary to coronary artery bypass graft surgery Stroke 2003 34 2830 2834 15 Bendszus M Koltzenburg M Burger R Warmuth Metz M Hofmann E Solymosi L Silent embolism in diagnostic cerebral angiography and neurointerventional procedures a prospective study Lancet 1999 354 1594 1597 16 Heckmann JG Lang CJ Kindler K Huk W Erbguth FJ Neundorfer B Neurological manifestations of cerebral air embolism as a complication of central venous catheterisation Crit Care Med 2000 28 1621 1625 17 van der Linden J Casimir Ahn H When do cerebral emboli appear during open heart operations A transcranial Doppler study Ann Thorac Surg 1991 51 237 241 18 Pugsley W Klinger L Paschalis C Treasure T Harrison M Newman S The impact of microemboli during cardiopulmonary bypass on neuropsychological functioning Stroke 1994 25 1393 1399 19 Dexter F Hindman BJ Recommendations for hyperbaric oxygen therapy of cerebral arterial gas embolism based on a mathematical model of bubble absorption Anesth Analg 1997 84 1203 1207 20 Mitchell S Pellett O Gorman DF Cerebral protection by lidocaine during cardiac operations Ann Thorac Surg 1999 67 1117 1124 21 Murphy BP Harford FJ Cramer FS Cerebral air embolism resulting from invasive medical procedures Treatment with hyperbaric oxygen Ann Surg 1985 201 242 246 22 Ziser A Adir Y Lavon H Shupak A Hyperbaric oxygen therapy for massive arterial air embolism during cardiac operations J Thorac Cardiovasc Surg 1999 117 818 821 23 Benson J Adkinson C Collier R Hyperbaric oxygen therapy of iatrogenic cerebral arterial gas embolism Undersea Hyperb Med 2003 30 117 126 Anaesthesia and Intensive Care Vol 38 No 1 January 2010 183 24 Sayama T Mitani M Inamura T Yagi H Fukui M Normal diffusion weighted imaging in cerebral air embolism complicating angiography Neuroradiology 2000 42 192 194 25 Muth CM Shank ES Gas embolism N Engl J Med 2000 342 476 482 26 Dutka A Air or gas embolism In Camporesi E Barker A eds Hyperbaric Oxygen Therapy a critical review Bethesda MD UHMS 1991 p 1 10 27 Hinkle DA Raizen DM McGarvey ML Liu GT Cerebral air embolism complicating cardiac ablation procedures Neurology 2001 56 792 794 28 Tomatis L Nemiroff M Riahi M Visser J Visser E Davies A et al Massive arterial air embolism due to rupture of pulsatile assist device successful treatment in the hyperbaric chamber Ann Thorac Surg 1981 32 604 608 29 Amory DW Grigore A Amory JK Gerhardt MA White WD Smith PK et al Neuroprotection is associated with beta adrenergic receptor antagonists during cardiac surgery evidence from 2 575 patients J Cardiothorac Vasc Anesth 2002 16 270277 30 Mangano DT Aspirin and mortality from coronary bypass surgery N Engl J Med 2002 347 1309 1317 31 Gorji R Camporesi E Hyperbaric oxygen therapy in the treatment of carbon dioxide gas embolism Undersea Hyperb Med 2004 31 285 289 32 Tovar EA Del Campo C Borsari A Webb RP Dell JR Weinstein PB Postoperative management of cerebral air embolism gas physiology for surgeons Ann Thorac Surg 1995 60 1138 1142 33 Helps SC Meyer Witting M Rilley PL Gorman DF Increasing doses of intracarotid air and cerebral blood flow in rabbits Stroke 1990 21 1340 1345 34 Nossum V Hjelde A Brubakk A Small amounts of venous air embolism cause delayed impairment of endothelial function and increase polymorphonuclear neutrophil infiltration Eur J Appl Physiol 2002 86 209 214 35 Thom SR Functional inhibition of neutrophil B2 integrins by hyperbaric oxygen in carbon monoxide mediated brain injury Toxicol Appl Pharmacol 1993 123 248 256 36 Ely EW Hite RD Baker AM Johnson MM Bowton DL Haponik EF Venous air embolism from central venous catheterization a need for increased physician awareness Crit Care Med 1999 27 2113 2117 37 Khazei A Harrison D Abu Laban R Mitra A Potential missed cerebral arterial gas embolism in patients with in hospital ischaemic stroke Diving and Hyperbaric Medicine 2007 37 58 64 38 Fries CC Levowitz B Adler S Cook AW Karlson KE Dennis C Experimental cerebral gas embolism Ann Surg 1957 145 461 470 39 Pierce EC Cerebral gas embolism with special reference to iatrogenic accidents HBO Review 1980 3 161 178 40 Blanc P Boussages A Henriette K Sainty JM Deleflie M Iatrogenic cerebral air embolism importance of an early hyperbaric oxygenation Intensive Care Med 2002 28 559 563 41 Reust RS Diener BC Stroup JS Haraway GD Hyperbaric treatment of arterial carbon dioxide embolism occuring after laparoscopic surgery A case report Undersea Hyperb Med 2006 33 317 320 42 Rusyniak DE Kirk MA May JD Kao LW Brizendine EJ Welch JL et al Hyperbaric oxygen therapy in acute ischemic stroke results of the Hyperbaric Oxygen in Acute Ischemic Stroke Trial Pilot Study Stroke 2003 34 571 574

Page 214

184 A J GIBSON F M DAVIS 43 Anderson DC Bottini AG Jagiella WM Westphal B Ford S Rockswold GL et al A pilot study of hyperbaric oxygen in the treatment of human stroke Stroke 1991 22 1137 1142 44 Nighoghossian N Trouillas P Adeleine P Salord F Hyperbaric oxygen in the treatment of acute ischaemic stroke a doubleblind pilot study Stroke 1995 26 1369 1372 45 Ericsson J Gottieb J Sweet R Closed chest cardiac massage in the treatment of venous air embolism N Engl J Med 1964 270 1353 1354 46 Mills NL Ochsner JL Massive air embolism during cardiopulmonary bypass Causes prevention and management J Thorac Cardiovasc Surg 1980 80 708 717 47 Baskin S Wozniak R Hyperbaric oxygenation in the treatment of haemodialysis associated air embolism N Engl J Med 1975 293 184 185 48 Hart GB Treatment of decompression illness and air embolism with hyperbaric oxygen Aerospace Med 1974 45 1190 1193 49 Bennett M The evidence basis of diving and hyperbaric medicine a synthesis of the high level clinical evidence with metaanalysis From www library unsw edu au thesis adt NUN public adt NUN20060808 155338 index html Accessed June 2008 50 Vila JF Balcarce PE Abiusi GR Dominguez RO Pisarello JB Improvement in motor and cognitive impairment after hyperbaric oxygen therapy in a selected group of patients with cerebrovascular disease a prospective single blind controlled trial Undersea Hyperb Med 2005 32 341 349 51 Sviri S Woods WP Van Heerden PV Air embolism a case series and review Crit Care Resusc 2004 6 271 276 Anaesthesia and Intensive Care Vol 38 No 1 January 2010

Page 215

For reprint orders please contact reprints futuremedicine com BULLETIN BOARD Cutting edge new study has major implications for the resuscitation protocol for cardiac arrest the number one cause of death in the West Study shows high dose hyperbaric oxygen therapy improves survival following cardiac arrest The study published in the August issue of Resuscitation tested the theory that high dose hyperbaric oxygen therapy would increase the window of survival and improve the return of sustained spontaneous circulation in test subjects compared with normobaric oxygen or standard dose hyperbaric oxygen following cardiopulmonary arrest Previous studies showed no evidence that porcine or human subjects could be resuscitated beyond a 15 min window following cardiac arrest The researchers found however that they were able to successfully resuscitate a group of laboratory swine using high doses of hyperbaric oxygen 25 min after cardiac arrest Current statistics of the American Heart Association however show that a patient s heart must be restarted within 16 min or a patient will die without any exception Lead author of the study Keith Van Meter stated that To resuscitate any living organism after 25 min of heart stoppage at room temperature has never been reported and suggests that the time to successful resuscitation in humans may be extended beyond the stubborn figure of 16 min that has stood for 50 years The study involved 18 male laboratory pigs in whom researchers induced cardiac arrest sustaining them in normothermic conditions for 25 mins without any form of cardiac intervention such as resusciataion artificial breathing support or drug therapy The subjects were then randomly separated future science group into three groups each comprising six animals One group receiving normobaric oxygen the second group standard dose hyperbaric oxygen and the third group receiving high dose hyperbaric oxygen All animals were then subsequently placed on an advanced cardiac life support ACLS system for 2 h periods in an attempt to resuscitate them The results were highly significant none of the animals from the first two groups survived however four out of six subjects in the highdose hyperbaric oxygen group were successfully resuscitated The present study shows that short term high dose hyperbaric oxygen is an effective resuscitation tool and is safe in a small multiplace hyperbaric chamber states Van Meter A rehearsed team can easily load a patient in cardiopulmonary arrest into a small multiplace chamber in the prehospital or hospital setting without interrupting CPR or www futuremedicine com advanced cardiac life support Successful resuscitation at 25 mins suggests that if high dose hyperbaric oxygen is used at the current ACLS limit of 16 mins a greater survival may be achieved in humans and allow application of more definitive treatment such as clot dissolving drugs This study thus offers the possibility of developing a hyperbaric resuscitation system that could potentially be used in a widespread clinical setting Further studies will however need to be conducted to determine the long term survival benefits of the high dose hyperbaric oxygen system and whether a single dose or multiple subsequent doses are required to maintain survival in patients Source Van Meter K Sheps S Kriedt F et al Hyperbaric oxygen improves rate of return of spontaneous circulation after prolonged normothermic porcine cardiopulmonary arrest Resuscitation 78 2 200 214 2008 455

Page 216

BULLETIN BOARD Priority Paper Alerts Circulating CD34 cell subsets in patients with coronary endothelial dysfunction Boilson BA Kiernan TJ Harbuzariu A Nelson RE Lerman A Simari RD Nat Clin Pract Cardiovasc Med 5 8 489 496 2008 Endothelial dysfunction is an early expression of atherosclerotic disease The present study sought to establish whether the circulating cells that express CD34 have a role in the appearance and progression of atherosclerosis A total of 57 coronary angiography patients were tested for coronary endothelial dysfunction Blood samples were obtained from all patients and mononuclear cells were extracted and analyzed for CD14 CD34 CD45 CD133 and VEGF receptor VEGFR 2 using flow cytometry Samples were then cultured for functional analysis Patients with coronary endothelial dysfunction demonstrated a reduced quantity of circulating CD34 CD45 dim VEGFR2 cells CD34 CD45 dim CD133 VEGFR2 cells and colony forming units compared with those patients with normal coronary endothelial function The study thus demonstrates that differences in levels of particular cellular subsets may be an early indicator of atherosclerosis Prevention of ventricular arrhythmias with sarcoplasmic reticulum Ca2 ATPase pump overexpression in a porcine model of ischemia reperfusion Prunier F Kawase Y Gianni D et al Circulation 2008 Epub ahead of print This study examined whether overexpression of the sacrcoplasmic reticulum Ca2 ATPase pump SERCA2a could cause a decrease in ventricular arrhythmias by modulating postischemic Ca2 overload Ventricular arrhythmias occur during heart failure and myocardial ischemia creating an increased diastolic Ca2 overload that leads to electrical instability in the heart The researchers produced SERCA2a overexpression in porcine hearts using adenovirus gene delivery into the main coronary arteries The left anterior descending coronary artery was subsequently occluded for 30 mins to induce myocardial ischemia followed by reperfusion ECG Holter recordings were conducted for a 24 h period following reperfusion and revealed a significant decrease in ventricular tachycardia following reperfusion The study demonstrated that cycling modulation of Ca2 overload by means of SERCA2a overexpression reduces ventricular arrhythmias following myocardial ischemia and reperfusion This offers the possibility for developing therapies to treat ventricular arrhythmias after myocardial ischemia by managing the postischemic Ca2 overload 456 New ultrasound test allows early detection of peripheral artery disease Researchers at the Oregon Health and Science University School of Medicine OR USA have developed a new ultrasound imaging technique that may be used to detect the early signs of peripheral artery disease PAD that currently go undetected by the standard forms of testing The method was developed by Jonathan R Lindner Professor of Cardiovascular Medicine at the University of Virginia Charlottesville VA USA and colleagues in which stress rest perfusion imaging with contrastenhanced ultrasound CEU was utilized to image skeletal muscle and vasculature in the legs Lindner said We found that contrast enhanced ultrasound imaging outperformed most conventional forms of diagnostics in measuring and evaluating impairment in a patient s ability to recruit blood flow in the legs during modest exercise Approximately 8 million Americans including 12 20 of people over 65 years of age are affected by PAD The condition involves the development of atherosclerosis stenosis or thrombus formation in the vasculature of the lower extremities causing acute or chronic ischemia in the legs The presence of PAD also poses another serious health risk as it increases the risk of mortality from heart attack or stroke by three to four times compared with people who do not have PAD The disease is also particularly dangerous for diabetics as more advanced forms of PAD can lead to gangrene which may require amputation of affected limbs The study involved 39 PAD patients and 26 control subjects who were injected intravenously with lipid shelled microbubbles that act as a contrast agent in ultrasound images The participants Future Cardiol 2008 4 5 performed moderate calf exercises such as plantar flexion movements and treadmill exercises for 2 min They were then measured with the ankle brachial index ABI and microvascular blood flow was evaluated in the gastronemicus and soleus muscles both at rest and following the exercises The new test allowing detection of the early symptoms of PAD would enable clinicians to offer early treatment of the disease and thus help patients to avoid developing more serious abnormalities at a later stage when more invasive therapy may be required The real benefit of a test like this which only takes about 5 mins to do and doesn t require anything beyond the equipment and capabilities already in place in most vascular laboratories is their value for selecting the right therapies concludes Lindner Peripheral arterial disease is becoming a huge problem because of the aging of the population and the increasing incidence of diabetes said Lindner But we don t have good diagnostics for it partly because a lot of the methods we have are based on measuring what s going on in the big vessels the arteries and veins How well the microcirculation system is functioning is what determines how well tissue is getting fed which is the critical issue More studies are needed on those patients who do not yet have a diagnosis of PAD however the test has already been approved for human use and may soon be made available for widespread use in clinics Source Lindner JR Womack L Barrett EJ et al Limb stress rest perfusion imaging with contrast ultrasound for the assessment of peripheral arterial disease severity JACC Cardiovascular Imaging 1 343 350 2008 future science group

Page 217

BULLETIN BOARD Greater quality of life found for those using bosentan in peripheral artery hypertension A new study by researchers in Australia has found the drug bosentan significantly improves quality of life scores and functional status in the 6 min walking test 6MWT in patients with peripheral arterial hypertension PAH a rare but usually deadly condition PAH is a progressive disease of the pulmonary vasculature in which increased pulmonary vascular resistance and an elevated blood pressure gradually weakens the heart eventually leading to right sided heart failure Prognosis for the condition is generally poor as no cure currently exists therefore placing greater importance upon psychological assessments and quality of life scores for the patient Bosentan is an oral dual endothelinreceptor antagonist that was found to notably improve blood flow functional capacity and survival of sufferers Lead author Geoff Strange commented that Quality of life is an important consideration in the treatment of diseases such as PAH in which prognosis is typically poor In such chronic diseases patients view improvement in quality of life as an important measure of treatment success The study was an open label multicenter trial involving patients with familial or idiopathic PAH or PAHrelated diseases Each participant was administered bosentan 62 5 mg twice daily increasing to 125 mg twice daily after 1 month Physical tests and quality of life the Medical Outcomes Study 36 item short form health survey assessments were carried out at weeks 1 3 and 6 and at 3 month intervals thereafter From baseline to 3 months patients demonstrated significant improvements in exercise capabilities during the 6MWT and had enhanced quality of life scores which continued to improve to 6 months However the correlation between these two markers of improvement was not maintained over time in response to bosentan therapy Professor Eli Gabbay a co author of the study from the Royal Perth Hospital and The University of Western Australia says While quality of life and 6MWT data were parallel at individual points quality of life may improve on bosentan therapy independent of the improvements in 6MWT The quality of life domains should be specifically assessed to improve the monitoring of patients with PAH as changes in quality of life cannot be extrapolated from routine clinical variables Source Strange G Keogh AM Williams TJ Wlodarczyk J McNeil KD Gabbay E Bosentan therapy in patients with pulmonary arterial hypertension the relationship between improvements in 6 minute walk distance and quality of life Respirology 5 674 682 2008 New research sheds light on the mechanism of action of ezetimibe a cholesterol lowering drug Most of the cholesterol lowering drugs such as statins inhibit the body s own synthesis of cholesterol However ezetimibe has a different mechanism of action in that it decreases cholesterol absorption in the intestine thus reducing the amount of cholesterol uptake from the diet Recent research conducted at the Shanghai Institutes for Biological Sciences China reveal the mechanism of action of ezetimibe The research group led by Bao Liang Song said that ezetimibe was found to act by blocking entry into a cell of the cholesterol carrying protein Niemann Pick C1 like 1 NPC1L1 This is a polytopic transmembrane protein that is a key player in cholesterol absorption It was found that cholesterol causes the internalization of NPC1L1 via future science group endocytosis In the presence of ezetimibe NPC1L1 is not internalized into clathrin coated vesicles thus endocytosis is prevented and the uptake of cholesterol into the cell is reduced This is a breakthrough in terms of understanding how cholesterol is absorbed said Bao Liang Song of Shanghai Institutes for Biological Sciences Now we see how NPC1L1 is recycled between the cell surface and vesicles inside the cell and how it takes in cholesterol Understanding the mechanism of cholesterol uptake can help identify potential drug targets for cholesterolabsorption inhibitors If we can uncover the players we can try to identify new small molecules to interfere with the process Song added www futuremedicine com Studies in patients have shown that ezetimibe can significantly reduce blood cholesterol concentrations in some individuals but cause very little difference in others Therefore there is an urgent need for more cholesterol uptake inhibitory drugs Song stated Our work provides the molecular basis for developing additional cholesterol absorption inhibitors Moreover the cell based assay that we have established can potentially be used to screen for novel inhibitors of NPC1L1 endocytosis which will block cholesterol uptake eventually Source Ge L Wang J Qi W et al The cholesterol absorption inhibitor ezetimibe acts by blocking the sterol induced internalization of NPC1L1 Cell Metab 7 6 508 519 2008 457

Page 218

Coronary Care Cardiology 1998 90 131 136 Yuri Stavitsky a Adrian H Shandling a Myrvin H Ellestad a George B Hart b Bruce Van Natta a John C Messenger a Michael Strauss b Milica N Dekleva c John M Alexander d Michael Mattice e Dick Clarke f a b c d e f Departments of Cardiology and Baromedicine Long Beach Memorial Medical Center Long Beach Calif USA Zemun Clinical Hospital Center University of Belgrade Yugoslavia Northridge Heart Institute Northridge Hospital Medical Center Northridge Calif Indian River Memorial Hospital Vero Beach Fla Richland Memorial Hospital Columbia S C USA OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO Key Words Myocardial infarction Thrombolysis Hyperbaric oxygen Received April 22 1998 Accepted after revision May 15 1998 Hyperbaric Oxygen and Thrombolysis in Myocardial Infarction The HOT MI Randomized Multicenter Study OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO Abstract In a previous pilot study we demonstrated that adjunctive treatment with hyperbaric oxygen HBO appears to be feasible and safe in patients with acute myocardial infarction AMI and may result in an attenuated rise in creatine phosphokinase CPK more rapid resolution of pain and ST changes This randomized multicenter trial was organized to further assess the safety and feasibility of this treatment in human subjects Patients with an AMI treated with recombinant tissue plasminogen activator rTPA or streptokinase STK were randomized to treatment with HBO combined with either rTPA or STK or rTPA or STK alone An analysis included 112 patients 66 of whom had inferior AMIs p NS The remainder of the patients had anterior AMIs The mean CPK at 12 and 24 h was reduced in the HBO patients by approximately 7 5 p NS Time to pain relief was shorter in the HBO group There were 2 deaths in the control and 1 in those treated with HBO The left ventricle ejection fraction LVEF on discharge was 51 7 in the HBO group as compared to 48 4 in the controls p NS The LVEF of the controls was 43 4 as compared to 47 6 for those treated approximately 10 better no significant difference Treatment with HBO in combination with thrombolysis appears to be feasible and safe for patients with AMI and may result in an attenuated CPK rise more rapid resolution of pain and improved ejection fractions More studies are needed to assess the benefits of this treatment OOOOOOOOOOOOOOOOOOOOOO Introduction Hyperbaric oxygenation HBO is an inhalation therapy in which the patient inspires pure oxygen at 11 atm absolute pressure A hermetic chamber is used to pressurize the inspired oxygen HBO treatment increases plasma concentrations of dissolved oxygen and this effect may normalize or even increase oxygen tensions to hyper ABC Fax 41 61 306 12 34 E Mail karger karger ch www karger com 1998 S Karger AG Basel 0008 6312 98 0902 0131 15 00 0 Accessible online at http BioMedNet com karger oxic levels in ischemic tissue 1 2 HBO is a useful modality for treatment of diseases in which tissue oxygen availability is decreased such as osteoradionecrosis compromised skin grafts carbon monoxide poisoning and acute traumatic ischemia e g crush injury 3 4 Studies using HBO in the animal model of compartment syndromes demonstrate a preservation of skeletal muscle and adenosine triphosphatase activity 5 6 In animal stud Myrvin H Ellestad MD FACC Memorial Heart Institute Long Beach Memorial Medical Center 2801 Atlantic Avenue Long Beach CA 90801 USA Fax 1 310 933 3372

Page 219

ies HBO also reduces the ischemic effects of coronary artery occlusion 7 10 However prior human trials detected little substantial benefit from HBO without concomitant thrombolysis 11 14 The only controlled trial done in the prethrombolytic era revealed a trend but no statistically significant mortality benefit when standard methods of analysis were used 15 The failure of these studies to demonstrate a benefit of HBO may be due to the fact that HBO alone does not prevent thrombus formation which is the major cause of acute myocardial infarction AMI 16 Thrombolytic agents are now increasingly used for the adjunctive management of acute coronary artery occlusion in order to reduce mortality and help prevent myocardial damage 17 21 In general these studies demonstrate only modest improvements in left ventricular ejection fraction LVEF 22 25 Because myocardial necrosis following AMI is caused by tissue hypoxia or anoxia it seems reasonable to hypothesize that thrombolytic therapy in combination with HBO will limit the amount of ischemic injury in acute thrombotic coronary artery occlusion The animal study published by Thomas et al 26 provides encouraging evidence for the validity of this hypothesis In our previous randomized pilot HOT MI study 27 we demonstrated the feasibility and safety of the combination of recombinant tissue plasminogen activator rTPA and HBO treatment The following randomized multicenter study was designed to further assess the benefit of thrombolysis in combination with HBO in patients with AMI Materials and Methods The study population consisted of patients admitted to the emergency departments at the following study locations Long Beach Memorial Medical Center Long Beach Calif USA Zemun Clinical Hospital Center University of Belgrade Yugoslavia Northridge Hospital Medical Center Northridge Calif USA Indian River Memorial Hospital Vero Beach Fla USA and Richland Memorial Hospital Columbia S C USA These study participants ranging in age from 18 to 80 years showed symptoms and signs suggestive of an AMI and were treated at one of the above locations between August 1989 and December 1997 This diagnosis was predicated on the finding of ST elevation 61 mm in two adjacent ECG leads and chest pain 620 min but 6 h in duration unrelieved by sublingual nitroglycerin Exclusion criteria including suspected aortic dissection recent surgery recent peptic ulcer disease or stroke were standard for thrombolysis Further exclusions pertaining predominantly to hyperbaric treatment included 1 severe claustrophobia 2 chronic obstructive pulmonary disease COPD with marked CO2 retention 3 patients with Killip class IV myocardial infarctions cardiogenic shock or Killip class III myocardial infarction with shortness of breath not rapidly controlled with intravenous medications 4 he 132 Cardiology 1998 90 131 136 modynamically compromising ventricular or atrial tachyarrhythmias or bradyarrhythmias not responding rapidly to standard medical treatment 5 patients with previous transmural anterior myocardial infarctions 6 inability to equilibrate pressure in the middle ear space secondary to upper respiratory tract infections allergic rhinitis or otitis The rTPA dose was 100 mg starting with 60 mg in the first hour of which 12 mg was administered as a bolus over the first 1 2 min and 20 mg over each of the second and third hour respectively Patients weighing 65 or 185 kg received 1 25 mg kg rTPA prorated ot the above schedule Streptokinase STK was administered at the dose of 1 5 MU in 100 ml of normal saline in a soluset system over 60 min Both groups received an enteric coated aspirin 325 mg before commencement of thrombolysis and 160 mg of aspirin daily thereafter at least for the duration of their hospital stay Patients were anticoagulated with heparin as a 5 000 unit intravenous bolus just before termination of rTPA infusion This was followed by an intravenous heparin infusion to maintain a partial thromboplastin time of 60 90 s for at least 3 days or until definitive intervention Those receiving STK were not treated with heparin With a random number table patients were randomized to thrombolytic therapy alone or thrombolytic therapy with HBO The patients randomized to HBO were then immediately transferred to the hyperbaric unit for a single treatment The patients were pressurized during a 30 min period up to 2 atm absolute pressure equivalent to 33 feet of sea water pressure They remained at this pressure for 60 min and then they were depressurized to surface pressure over a 30 min period Total time for the HBO treatment was 2 h A critical care nurse and cardiology fellow or cardiologist were in attendance at all times Small doses 5 mg total of diazepam Valium were utilized intravenously as necessary for sedation Monitoring of electrocardiograms noninvasive blood pressures and other vital signs was performed during HBO treatments in the same fashion as in the cardiac care unit Those patients randomized to thrombolysis alone the control group were transferred to the cardiac care unit for routine monitoring and therapy They received 6 liters of oxygen by nasal cannula or 40 oxygen by face mask for at least 3 h after admission to the cardiac care unit All patients received intravenous nitroglycerin in doses of 20 200 mg min titrated to pain and blood pressure Creatine phosphokinase CPK and CPK MB samples were obtained upon admission and every 4 h for 24 h Electrocardiograms were performed at 1 hour intervals for the first 3 h thereafter every 4 h for 24 h and daily for 3 days after this The time to pain relief was recorded The time taken for resolution of ST elevation to 1 mm was estimated from recorded electrocardiograms All patients underwent standard post AMI management including angiography angioplasty and coronary artery bypass when indicated An LVEF was determined from a predischarge resting nuclear ventricular function study or an echocardiogram utilizing observer blinding Study Designs and Statistics This project was designed as a prospective randomized clinical multicenter trial but was not conducted on an intention to treat basis because of the small sample size The statistical tests used for comparison include Student s t test 2 test with Yates correction or Fisher s exact test where appropriate The study protocol had the approval of the institutional review board at Long Beach Memorial Medical Center We were largely dependent on the data forwarded to us by the other participating centers Some of the data sheets were not complete so we could use only available data for the statistical analy Stavitsky Shandling Ellestad Hart Natta Messenger Strauss Dekleva Alexander Mattice Clarke

Page 220

sis of the corresponding variables All patients recruited at the American centers received rTPA and all patients from the Zemun Clinical Hospital Center University of Belgrade Yugoslavia were treated with STK We did not collect data from those whose physicians refused to have their patients included or those who were transferred out of our facility by their HMO soon after randomization Results Of the 138 patients originally considered for the study 16 were subsequently excluded Four patients were excluded because of hemodynamic instability in the emergency room Of these 3 were taken for emergent coronary angiography and the 4th randomized to HBO but not treated died in the emergency room Two patients were subsequently found to have no enzymatic evidence of AMI and were excluded Three patients were excluded because careful review revealed that the time limit for rTPA administration had been exceeded 16 h One patient refused entry into the HBO chamber after consenting to the treatment and 1 patient received the incor Table 1 Demographics n 112 Males Females Age years Anterior AMI Inferior AMI Undetermined location Thrombolysis only n 63 Thrombolysis HBO n 59 p value 48 76 15 24 59B11 7 29 48 32 52 2 3 2 49 83 10 17 58B11 1 24 41 34 59 1 1 7 NS NS NS NS NS NS rect protocol One patient who subsequently died could not receive HBO treatment since the chamber was already occupied by another research study patient Four patients were excluded because of incomplete data sets no predischarge LVEF One patient received only half of the 2hour HBO treatment due to feelings of claustrophobia in the HBO chamber and he has been included in the HBO treatment group for analysis purposes The patient demographics listed in table 1 reveal that the patients in each group are well matched There was no significant difference between study groups with regard to the prevalence of diabetes hypertension chronic obstructive pulmonary disease prior myocardial infarction previous coronary bypass or smoking history Time from initiation of rTPA to initation of HBO treatment averaged 71 min Three patients from the Long Beach Medical Center in the control group and 4 in the HBO group had runs of nonsustained ventricular tachycardia including accelerated idiventricular tachycardia The distribution of AMI sites is not significantly different between study groups table 1 The groups are also similarly matched for time of pain onset to the time of administration of thrombolytics The HBO group had earlier resolution of chest pain a lower rise in CPK a greater predischarge LVEF and 1 death There were 2 deaths among those receiving rTPA alone Only the time to pain resolution reached statistical significance These data are summarized in table 2 Positive dynamics in ST change resolution was observed virtually in every patient treated with HBO fig 1 Unfortunately we were unable to analyze the electrocardiographic data due to incomplete information from participating centers There were no major bleeding complications in either group Patients in both groups were evenly distributed in either Killip class I or II There were no significant differences between the two groups Table 2 Clinical variables Deaths CPK on admission 12 hour CPK 24 hour CPK Maximum CPK Pain onset to TPA min Time to pain relief min TPA to angiography time h Ejection fractions Hyperbaric Oxygen in Myocardial Infarction n Thrombolysis only n Thrombolysis HBO p value 63 44 43 36 57 38 41 23 60 2 3 2 394B666 6 1 828B1 654 9 1 093B1 200 9 2 111B1 641 7 199B126 614B428 40B29 48 4B12 9 59 42 41 36 53 34 40 26 57 1 1 7 215B181 9 1 690B1 293 6 1 028B769 8 1 698B1 400 5 191B165 261B99 54B42 51 7B11 2 NS NS NS NS NS NS 0 001 NS NS Cardiology 1998 90 131 136 133

Page 221

Page 222

consequently improved penetration of oxygen into hypoxic tissues casued by the facilitation of oxygen diffusion Tissue oxygen tensions remain elevated for some hours following the cessation of HBO treatment 28 Thus the tissues remain oxygenated after completion of the HBO treatment This could result in sustained beneficial effects even after decompression and allow for improved myocardial salvage in that group of patients who have late reperfusion There is evidence that hyperoxia induces generalized vasoconstriction It has been demonstrated in the context of limb circulation that blood flow is decreased by 8 9 at 2 atm absolute pressure as a result of vasoconstriction Despite this tissue oxygen still increases by 18 29 A recent study has demonstrated that progressive ischemic arteriolar vasoconstriction seen in arterioles close to ischemic venules is inhibited with HBO treatment in animals 30 In the current study either rTPA or STK was utilized as the only thrombolytic agent because it is reported to provide earlier coronary arterial patency 31 This factor may offer the potential for more myocaridal salvage with the conjunctive use of HBO There was initially concern that an increase in free oxygen radical generation occasioned by the high oxygen tension state of HBO treatment would potentiate tissue reperfusion injury The results from our study group of patients do not suggest that this mechanism occurs to any appreciable clinical degree in patients treated with HBO Recent investigational work by Zamboni et al 30 has shown that reperfusion injury may actually be inhibited by HBO by a decrease in leukocyte venular endothelial adherence release of toxic oxygen species and consequent arteriolar vascoconstriction The result is that progressive arteriolar vascoconstriction is inhibited 30 Thus far this effect of HBO has only been studied in an in vitro rat skeletal muscle preparation Our study demonstrates lower maximum CPK levels and at both 12 and 24 h in the HBO treated group p NS Increased myocardial salvage seems to be the likely explanation given the higher predischarge LVEF in the HBO treated group and the reduced time to pain relief In conclusion we have demonstrated the feasibility and safety of a combination of rTPA or STK and HBO treatment in this randomized multicenter trial All clinical data although statistically nonsignificant except time to pain resolution were better in patients who received thrombolysis and HBO No obvious acute adverse clinical sequelae of HBO enhanced reperfusion injury were observed In order to attain a sufficient level of statistical significance this study needs to be repeated on a larger patient sample Acknowledgments Thus study was funded in part by Genentech San Francisco Calif USA and the Memorial Foundation Long Beach Memorial Medical Center OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO References 1 Behnke AR High atmospheric pressures Physiological effects of increased and decreased pressure Application of these findings to clinical medicine Ann Intern Med 1940 13 2217 2228 2 Ackerman NB Brinkley FB Oxygen tensions in normal and ischemic tissues during hyperbaric treatment JAMA 1966 198 1280 1283 3 Thom SR et al Hyperbaric oxygen therapy a committee report Undersea and Hyperbaric Medical Society Bethesda 1992 pp 1 80 4 Grim PS Gottlieb LJ Boddie A Baston E Hyperbaric oxygen therapy JAMA 1990 263 2216 2220 5 Strauss MB Hargens AR Gershuni AH et al Reduction of skeletal muscle necrosis using intermittent hyperbaric oxygen in a model compartment syndrome J Bone Joint Surg 1983 65 656 662 Hyperbaric Oxygen in Myocardial Infarction 6 Nylander G Nordstrom H Lewis D Larsson J Metabolic effects of hyperbaric oxygen in postischemic muscle Plast Reconstr Surg 1987 79 91 96 7 Kawamura M Sakakibara K Sakakibara B Kidokora H Takahashi H Kobayashi S Konishi S Uno Y Protective effect of hyperbaric oxygen for temporary ischemic myocardium Macroscopic and histologic data Cardiovasc Res 1976 10 599 604 8 Trapp WG Creighton R Experimental studies of increased atmospheric pressure on myocardial ischemia after coronary ligation J Thorac Cardiovasc Surg 1964 47 687 692 9 Smith G Lawson DD The protective effect of inhalation of oxygen at two atmospheres absolute pressure in acute coronary arterial occlusion Surg Gynecol Obstet 1962 114 320 322 10 Meijne NG Bulterijs A Eloff SJP Boerema I An experimental investigation into the influence of administration of oxygen under increased atmospheric pressure upon coronary infarction J Cardiovasc Surg 1963 4 521 535 11 Whalen RE Saltzman HA Hyperbaric oxygenation in the treatment of acute myocardial infarction Prog Cardiovasc Dis 1968 10 575 583 12 Rude RE Muller JE Braunwald E Efforts to limit the size of myocardial infarcts Ann Intern Med 1981 95 736 761 13 Cameron AJV Hutton I Kenmure ACF Murdoch WR Haemodynamic and metabolic effects of hyperbaric oxygen in myocardial infarction Lancet 1966 ii 833 837 14 Ashfield R Gavey CJ Severe acute myocardial infarction treated with hyperbaric oxygen Report on forty patients Postgrad Med J 1969 45 648 654 Cardiology 1998 90 131 136 135

Page 223

15 Thurston JGB Greenwood TW Results of a controlled trial of hyperbaric oxygen in acute myocardial infarction Q J Med 1973 168 752 770 16 DeWood MA Spores J Notske MD et al Prevalence of total coronary occlusion during the early hours of transmural myocardial infarction N Engl J Med 1980 303 897 902 17 Bergman SR Fox KAA Ter Pogossian MM Sobel BE Clot selective thrombolysis with tissue type plasminogen activator Science 1983 220 1183 18 Sobel BE Geltman EM Tiefenbrunn AJ et al Improvement of regional myocardial metabolism after coronary thrombolysis with tissuetype plasminogen activator or streptokinase Circulation 1984 69 983 990 19 White HD Norris RM Brown MA et al Effect of intravenous streptokinase on left ventricular function and early survival after acute myocardial infarction N Engl J Med 1987 317 850 855 20 GISSI Effectiveness of intravenous thrombolytic treatment in acute myocardial infarction Lancet 1986 i 397 402 136 21 Gusto investigators An international randomized trial comparing four thrombolytic strategies for acute myocardial infarction N Engl J Med 1993 329 673 682 22 Granger CB White HD Bates ER et al A pooled analysis of coronary arterial patency and left ventricular function after intravenous thrombolysis for acute myocardial infarction Am J Cardiol 1994 74 1220 23 I S A M Study Group A prospective trial of intravenous streptokinase in acute myocardial infarction I S A M N Engl J Med 1986 314 1465 1471 24 Van de Werf F Arnold AER Intravenous tissue plasminogen activator and size of infarct left ventricular function and survival in acute myocardial infarction BMJ 1988 297 1374 1379 25 Martin GV Sheehan FH Stadius M et al Intravenous streptokinase for acute myocardial infarction Circulation 1988 78 258 266 26 Thomas MP Brown LA Sponseller DR Williamson SE Diaz JA Guyton DP Myocardial infarct size reduction by synergistic effect of hyperbaric oxygen and recombinant tissue plasminogen activator Am Heart J 1990 120 791 800 Cardiology 1998 90 131 136 27 Shandling AH Ellestad MH Hart GB Crump R Marlow D Van Natta B Messenger JC Strauss M Stavitsky Y Hyperbaric oxygen and thrombolysis in myocardial infarction The HOT MI Pilot Study Am Heart J 1997 134 544 550 28 Swift PC Turner JH Oxer HF O Shea JP Lane GK Woollard KV Myocardial hibernation identified by hyperbaric oxygen treatment and echocardiography in postinfarction patients Comparison with exercise thallium scintigraphy Am Heart J 1992 124 1151 29 Bird AD Telfer ABM Effect of hyperbaric oxygen on limb circulation Lancet 1966 i 355 356 30 Zamboni WA Roth AC Russell CR et al Morphologic analysis of microcirculation during reperfusion of ischemic skeletal muscle and the effect of hyperbaric oxygen Plast Reconstr Surg 1993 91 1110 1123 31 The effects of tissue plasminogen activator streptokinase or both on coronary artery patency ventricular function and survival after acute myocardial infarction The GUSTO Angiographic Investigators N Engl J Med 1993 329 1615 1622 Stavitsky Shandling Ellestad Hart Natta Messenger Strauss Dekleva Alexander Mattice Clarke

Page 224

Page 225

Page 226

Journal of Stem Cell Therapy and Transplantation Open Access Research Article ISSN 2577 1469 Stem cells in patients with heart failure experience Benetti Federico1 2 and Natalia Scialacomo1 2 Cardiac Surgeons Department of Surgery Benetti Foundation Alem 1846 Rosario Argentina 1 Regenerative Medicine Department of Surgery Benetti Foundation Alem 1846 Rosario Argentina 2 Address for Correspondence Benetti Federico Cardiac surgeons Regenerative Medicine Department of Surgery Benetti Foundation Alem 1846 Rosario Argentina Tel 543415076262 Email federicobenetti hotmail com Submitted 30 March 2018 Approved 18 April 2018 Published 20 April 2018 Copyright 2018 Federico B et al This is an open access article distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited Keywords Stem cells in patients with hear failure Hyperbaric oxygen and angiogenesis in heart failure patients Treatment of idiopathic myocadiopathy with stem cells Autologous stem cells in patients with cardiac insuf ciency Embryophetal cells in patients with heart failure Abstract Between 2003 and 2011 17 patients with heart failure were treated with stem cells as part of our Foundation s Regenerative Medicine program In several centers and countries 4 with ischemic cardiomyopathy of which 3 were surgically implanted with autologous bone marrow stem cells ABMSC plus bypass surgery One patient was treated with hyperbaric medicine plus bypass surgery Patients with idiopathic cardiomyopathy were implanted surgically with 2 different types of stem cells Ten patients were implanted with stem cells derived from human fetuses HFDSCs and three patients with autologous bone marrow stem cells ABMSC The ejection fractions of the coronary artery bypass graft off pump OPCAB control group versus coronary artery bypass group off pump OPCAB plus stem cell transplantation were as followsin the entire serie preoperative 30 7 2 5 compared to 29 4 3 6 1 month 36 4 2 6 versus 42 1 3 5 3 months 36 5 3 0 vs 45 5 2 2 And 6 months 37 2 3 4 versus 46 1 1 9 p

Page 227

Page 228

Page 229

Page 230

Page 231

Page 232

Page 233

Page 234

Page 235

Stem cells in patients with heart failure experience References 1 Remme WJ Swedberg K Task force for the diagnosis and treatment of chronic heart failure European Society of Cardiology Guidelines for the diagnosis and treatment of chronic heart failure European Heart Journal 2001 22 1527 1560 Ref https goo gl ENjTdx 2 Colucci W Braunwald E Pathophysiology of Heart Failure en Heart Disease de Braunwald 5a Edition 1997 360 393 3 Enrique V Carbajal MD Prakas Current Diagnosis and Treatment is Cardiology 2nd Ed Congestive Heart Failure 2003 4 Bolling SF Pagani FD Deeb GM Intermediate term outcome of mitral reconstruction in cardiomyopathy J Thorac Cardiovasc Surg 1998 115 381 386 Ref https goo gl NiiBfR 5 Wang JS Shum D Galipeau J Marrow stromal cells for cellular cardiomyoplasty feasibility and potential clinical advantages J Thorac Cardiovasc Surg 2000 120 999 1006 Ref https goo gl 1tNxfM 6 Ra i S Lyden D Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration Nat Med 2003 9 702 712 Ref https goo gl 8D8Qqc 7 Orlic D Kassutra J Chimenti S Jakoniuk I Anderson SM et al Bone marrow cells regenerate infracted myocardium Nature 2001 410 701 705 Ref https goo gl VDLjv3 8 Edelberg JM Tang L Hattori K Lyden D Ra i S Young adult bone marrow derived endothelial precursor cells restore aging impaired cardiac angiogenic function Circ Res 2002 90 E89 E93 Ref https goo gl 2dmhJe 9 Shi Q Ra S Wu MH Wijelath ES Yu C et al Evidence for circulating bone marrow derived endothelial cells Blood 1998 92 362 367 Ref https goo gl z2fWF3 10 Sata M Saiura A Kunisato A Tojo A Okada S et al Hematopoietic stem cells differentiate into vascular cells that participate in the pathogenesis of atherosclerosis Nat Med 2002 8 403 409 Ref https goo gl HnCjtL 11 Otani A Kinder K Ewalt K Otero FJ Schimmel P et al Bone marrow derived stem cells target retinal astrocytes and can promote or inhibit retinal angiogenesis Nat Med 2002 8 1004 1010 Ref https goo gl sJ98ME 12 Young PP Ho ing AA Sands MS VEGF increases engraftment of bone marrow derived endothelial progenitor cells EPCs into vasculalture of newborn murine recipients Proc Natl Acad Sci USA 2002 99 11951 11956 Ref https goo gl TLhwpp 13 Heyboer M Milovanova TN Wojcik S Grant W Chin M et al CD34 CD45 dim stem cell mobilization by hyperbaric oxygen changes with oxygen dosage Stem Cell Res 2014 12 638 645 Ref https goo gl stqQak 14 O Donoghue K Fisk NM Fetal stem cells Best Pract Res Clin Obstet Gynaecol 2004 18 853 875 Ref https goo gl WFgYr9 15 Tsymbalyuk VI Yaminsky YY Usage of embryonic nerve tissue transplantation to improve the conductivity of spinal cord after traumatic damage in animals and humans Transplantology 2003 4 199 201 16 Zorin MO Yurchenko TN Latyshev DY 2003 Application of cryopreserved suspension of embryonic neural cells in combined treatment of patients with ischemic insults of basal ganglias Transplantology 4 149 50 17 Salogub TV Perspective of embryonic cell transplantation when treating patientswthepileptiform neuralgia of peripheric genesis Transplantology 2003 4 184 185 Ref https goo gl BKqVuR 18 Grischenko VI Bobirova LE DvornekIL y col 2003 Use of biotechnology in treatment of type I dabetes Transplantology 4 16 19 Published April 20 2018 13 14

Page 236

Stem cells in patients with heart failure experience 19 Benetti F Penherrera E Maldonado T Vera YD Subramanian V et al Direct Myocardial Implantation of Human Fetal Stem Cells in Heart Failure Patients Long term Results Heart Surg Forum 2010 13 Ref https goo gl FdnVfw 20 Benetti F Vi a RF Patel AN OPCABG plus simultaneous autologus stem cells implants TCTMD com june 2003 21 Patel AN Geffner L Vina RF Saslavsky J Kormos R et al Surgical treatment for congestive heart failure with autologous adult stem cell transplantation A prospective randomized study J Thorac Cardiovasc Surg 2005 130 1631 1638 Ref https goo gl XTr3sq 22 Meerson FZ The myocardium in hyperfunction hypertrophy and heart failure Circ Res 1969 25 1 163 Ref https goo gl ebUrEX 23 Zak R Cardiac hipertrophy biochemical and cellular relationships Hosp Pract 2016 18 85 97 Ref https goo gl 3rKRxD 24 Prosper F P rez A Merino J Adult stem cells for myocardial repair Basic ApplMyol 13 15 22 2003 25 Colucci WS Braunwald E Patophisiology of heart failure in Braunwald s Heart Disease 5th edition Saunders company 1997 26 Prockop DJ Marrow Stromal cells as Stem Cells for nonhematopoietic tissues Science 1997 276 71 74 Ref https goo gl m4UcND 27 Pittenger MF Mackay AM Beck SC Jaiswal RK Douglas R et al Multilineage potential of adult human mesenchymal stem cells Science 1999 284 143 147 Ref https goo gl UcXFMi 28 Makino S Fukuda K Miyoshi S Konishi F Kodama H et al Cardiomyocites can be generated from marrow stromal cells in vitro J Clin Invest 1999 103 697 705 Ref https goo gl N4GYGu 29 Xu M Wani M Dai YS Wang J Yan M et al Differentiation of bone marrow stromal cells into cardiac phenotype requires intracellular communication with myocites Circulation 2004 110 2658 2665 Ref https goo gl kQKnXu 30 Chedrawy EG Wang JS Nguyen DM Shum Tim D Chiu R Incorporation and integration of implanted myogenic and stem cells into native myocardial bres anatomic basis for functional improvements J Thorac Cardiovasc Surg 2002 124 584 590 Ref https goo gl wnW8fH 31 Pittenger MF Martin BJ Mesenchymal stem cells and their potential as cardiac therapeutics Circulation research 2004 95 9 20 Ref https goo gl MQHvLH 32 Vilas Boas F Feitosa GS Soares MB Pinho Filho JA Mota A et al Bone marrow cell transplantation to the myocardium of a patient with heart failure due to Chagas disease Arg Bras Cardiol 2004 82 181 184 Ref https goo gl 72WixZ Published April 20 2018 14 14

Cardiovascular Conditions & HBOT

Page 1

Page 2

Page 3

Page 4

Page 5

Page 6

Page 7

Page 8

Page 9

Page 10

Page 11

Page 12

Page 13

Page 14

Page 15

Page 16

Page 17

Page 18

Page 19

Page 20

Page 21

Page 22

Page 23

Page 24

Page 25

Page 26